>gi|78221228:1-20000 Geobacter metallireducens GS-15, complete genome
TGTCTCTTTAGCTGATATTGCAAAGAGAGTATCTTTAATCACAGCAACCATTGTCTGTCAAGTACAAATT
TACCTCCCTACGGTACATTTGGCCTTGCAAACGCCCCTCTCCTCTGCTAGTCTCCTCTATCCTGAGGCTA
CATCCAGCCTGTCCAGAATAGTAGCTTTTCCACTTCCAATACCTCAATTTATCAACAAAAATCCAGTTAT
TCACACCTGTTGACAACCATGTGTATAACTGGTCCCCGAGACTACCCTCTATGGAAGATGTTTGGCTCCA
GGCACAATCCAATCTGGCCAAAGTGCTCACGCACCAGACCTTCACCACCTGGATAGAGCCGATCAGGTTC
GCCGGAGCCCATAAGAATACTCTCCTCCTGGAGGCCCCCAACCAGTTCATCAGGGACCGGGTCAGAGAGA
GCTATCTTCCCATGATCCTCGAATCGGTCCGCTCCCTCACCGACTCCCACTTCCAGGTTGAACTCCAGGT
GGCGGCCCGGCAACAGGAAAAGACCGCGAAAAGCCCACGCAAAAGCCATACAGAGGATGAGCTCGGGCCC
GTTGAGTCGGAAAAATGCGCGCCTGCCGAATTTTCCACCAATCTGAACGCCAAGTATACCTTCGACACCT
TTGTCTGCGGCGGGAGCAACCAGTTCGCCCATGCAGCGGCCCTGTCGGTGGCCAACAACCCGGCCGGCAA
GTACAATCCACTTTTCATCTACGGCGGCGTGGGTCTGGGGAAAACCCATCTCCTGACGGCCATCGGCAAC
CAGGTTCTGACCAAGAACCGCAAGGCCCGGGTCTGTTTCTACACCTCCGAGAAATTCATGAACGAGCTCA
TCAATTGCCTCCGTTACCAGAAGATGGAGCAGTTCAGGAACAAGTTCCGCAAGATGGACCTCCTCCTCAT
CGACGACATCCAGTTCATCGCCGGCAAGGAACGGACCCAGGAAGAGTTTTTCCACACTTTCAACGCCCTC
TACGAGTCACACAAGCAGATCGTGGTCACCTCGGACAAGTTTCCCAAGGACATCCCCGGCCTGGAGGAAC
GGCTCCGCTCCCGCTTCGAGTGGGGACTCATCGCCGACATCCAGCCCCCGGACACCGAGACCAAGGTGGC
CATCCTCAGCAAGAAGGCCGATTCCGACGGCATCCGCCTTCCGGACGACGTGGCGCTCTTTCTTGCCTCC
AGCGCCAGCACCAACGTGCGGGAGCTGGAAGGGATGCTGATCCGCCTCGGCGCCGTGGCGAGCCTCACGG
GAAAGAACATCACCCTTGACATGGCCCGGGAGGTTCTGAAAGACATCATCGTCGACAAGACCAAAGAGGT
CACCGTGGAGATGATCCAGAAGTATGTGGCCGACCACTTCAACATCAAGGTGGCGGAGCTTAAGTCGGAC
AAGCGCCTCAAAGCGCTGGTGGTGCCACGCCAGATCGCCATTTACCTCTGCCGCGACCTGACCAAGGCCT
CGTACCCGGATATCGGGGAGAAATTCGGAGGGAAGGACCACTCGACCATCATCCACTCGGTGAAGAAGGT
GGACAAGCTCCTCTCCCAGGATTTCGAGCTGAAAAGCACCATTGAGACCCTGCGCAAGGGGCTGTTGAAC
TAAAGGGGACAACCCTGTGAATGGAGGGACCCTTTGTGGACAACCTTCCTATCCTTGACCGTCCGCTCCG
GGATAACCCGGCAGCCGTCAACAGGGAAGTACTGATAAAAATTGTGTTACTATCGTGAGTTACCGGGTTA
TCCCCGGATCCACAGCCCCTATTGCTTCTACTAAGCTTTAAAAAAGCATAAACATACTAATCTGCATCTG
TTGACAAGGAGGAGCGATGGAATTCAAGATCGACAAGGAAACCTTCTCCCGGGCTCTCCAGAAGATCCAG
GGAATCGTCGAAAAGAGGAACACCATGCCGATCCTCTCCAACGTCCTTATCGAGGCCCATGCCGATCGGA
TCGAGCTGACGGCCACGGACCTGGAAGTGGGAATGAAGAGTTCCTACGAGACGACTGTGACCCGGGAGGG
ACGAATCACCGTTTCGGCCAAGAAGCTCTACGAGATCGTCAAGGAACTCCCCGAGGAAGCCATCTCTTTC
GCCACCAAGGAGAACGACTGGGTGGAAATCCGCTGTGGCAAGGCCCATTTCAGCATCGTCGGCCTTTCCC
CCGAGGAGTTTCCCTATTTCCCCAAGGTGAACGAAGAGAGCCTGATCCGGATCGAGGGGGCGCTCCTGGC
CGACATGATCGAGAAGACCGCCTACGCCATCTGCTTCGACGAGACCAAGTACAACCTGAACGGCACCTTC
GTGAAGGCCACCGTTGAAGATGATAAACCGATTCTCCGGATGGTGGCCACCGACGGCCACCGCCTCTCCA
TCGCCGAGAAGGAATTCCACGGGGCCGTGGGGCCCGAGATGGCCAAGGGGGTCATCTTCCCCAAGAAGGG
TATCTTCGAGCTCAAGAAGATCTGCGAGGAGGCGACCACCGAAGAACTGGCCCTCGGCTTCATGGACAAC
AGCGCCGTCATCAAGAAGGGGAACACCGTGGTGGTGATGCGGCTCGTGGACGGTGAGTTCCCCGACTACA
CCCGCGTAGTCCCCGTGGCCAACGACAAGATCGTGACCGTGGCCCGGGATCCGTTCCTCCACTCCCTGCG
GCGGATGTCGATCCTCTCCAGCGAGAAGTTCAAGGGGATCCGGATGGAGATCAACGGCGAGCAGATGATC
ATCTCCTCCAGCAACCCTGAACTGGGGGAAGCGTCGGAGGAACTGGACGCGGCCTACAGCGGCCCTCCCC
TTTCCATCCGGTTCAATGCCAAGTACCTCCTGGACGTCCTGGCGGTCCTCAACGAGAGCGAAGTGGCGCT
GGTCCTCCGGGACGAGCTGTCGCCGGCCATCGTGAAACCGGCCGCGGTCGACGGTTTCACCGCGGTGATC
ATGCCGATGCGGCTGTAGGAAACAGTAACCGGCAGGCACGGAAGGCGAAGGCCCCTCCCCGGGAGAGGCC
TTTTGCCGTTCTTTCGGCTATAGAAACACCATGTTTGTGACGAAGATCCAGATCAGTTCCTTCCGGAACA
TCGCCGCGGCGGAGATCCGCTTCGACCGGCGCTTCAATGTCCTCCACGGCGCCAACGGCCAGGGGAAGAC
CTCGGTCCTGGAGGCCATCTATCTCCTGGGGACCATGAAGTCGTTTCGCCTCGCCAAGACCCCTGATCTT
GTCAGCTGGAACACCCCCCATGCGCTCCTGCGGGGATGGGCCGAGCGGGACGGGGTCGGCAGGGAGATCG
CCCTCTACCTGGGGAAGGAAGGCCGCAAAGCGAGGGTCGACCAGAAGCCGGTGACCCGGCTCGCCGATTT
CTTCGGCAACGTGAACGCCGTGGTCTTCTCCCCCGAGGAGATCGCCATGGCCCGCAGCGGCCCGGACCTC
CGGCGCCGCTACCTGGACCGGGCCATCTTCAGCGGAGATCTGGGGTACCTGCTCCTCCACCACGAGTACC
ACCGGCTCCTCAAGCAGCGCAACGCCCTGCTGAAGCGGGGAAGCCGGGAAGGGCTCGATATCTGGACCGG
ACAGCTGGCCGAAGCGGGTACCCGGCTCATGGTAAAGCGGATGGGATACCTGGCCGAGATAGAGCCGCTG
GTGCAACGGTTCTACCGGGAGATTGCCGGGGGCGAGGAAGAGGCGGGGCTTGCCTATCGTCCCCACCTCA
CTACCCCCGACTTGGTGAGTCGGGAGGGAACGGACGCGCTTCTGGCTCTCTTCGGGGCCCATGAGGCGGA
GGAACTCCGCCGGGGAACCACCGTGGTGGGCCCCCACCGGGACGACGTGGACTTCGTCCTGAACGGCCGG
GTGATCCGCACTCACGGCTCCCAGGGGCAACAGCGCAGCTTCGTCCTGGCCCTTAAGATGGCGGAGATCG
AGTACCTGGAGCGGCTCAACGACGCCCCGCCGGTGCTGCTCCTGGACGACATCTCGTCGGAGCTGGATCC
GCAGCGCAACGCGAATCTCATGACCTTCCTCCGGGAAAAGCGGATGCAGGTTTTCATCACCACCACCGAT
GTTTCAACCCTCCGCCTGGCGGGGATTGCAACCCACGCGTCCTTCCACGTTTCACGTGGAACGGTGACGC
CTTTATAGAGGGAGAAGTATGGCTGACGAACTGAACAACGATTACGGAGCGGACAAGATCAAGGTCCTTG
AGGGGCTCGAAGCTGTTCGCAAGCGCCCCGCCATGTACATCGGCTCAACCGCGAGCCAGGGGCTCCACCA
TCTGGTCTACGAGATTGTCGATAACTCCATCGACGAGGCCCTGGCCGGCTACTGCAACGAGGTGAACGTC
ACCATCCACCTGGACGGCTCCATTACGGTGGTGGACAACGGCCGGGGTATTCCCACCGAGATGCATCCCA
CTGAAGGGAAACCGGCGGCGGAGGTGGCCCTTACGGTTCTCCATGCCGGCGGTAAGTTCGATAATACGTC
ATACAAGGTGTCCGGCGGTCTCCACGGGGTCGGCGTATCGGTCGTTAACGCCCTGTCGAAAAAGCTTGAA
CTGGGAATTCGCCGTGACGGGAAGGTGTTTCAGCAGTCCTATGCCTACGGAGCACCGCTGACTCCCCTGG
AAATTGTGGGGGAGACCAAGAAACGGGGAACCAGAATCACTTTCCTCCCCGACGACACCATCTTCGAGAC
CACGGAATTTTCCTTCGATATTCTTTCCCAGCGGCTGCGGGAGCTGGCCTTCCTGAACGCCGGGGTGCGG
ATCACCATCTCCGACGAGCGGGAAGAGGGTAAACACCACGACTTTCACTACGAGGGGGGAATCGTCTCCT
TCGTGGAGTACCTGAACCGGAACCGAACCGTGCTCCATCCGAAACCGGTCTACTTCCGGGGTGAGAGGGC
GGGGATCGACATGGAGATCGCCATCCAGTACAACGACTCCTACGACGAGAAGGTTTTCACCTTTGCCAAC
AACATCAACACCCACGAGGGTGGTACCCACCTGGTGGGGTTCCGGGCGGCACTCACCCGCTCCATGAACT
CCTACGCCGCGGCCAACGAGCTGACGAAGAAGGAGAAGGTCTCCATCTCCGGCGAGGATCTGCGGGAGGG
GCTCACGGCGGTAATCTCAGTCAAGATTCCCCAGCCCCAGTTCGAGGGGCAGACCAAGACCAAGCTTGGG
AACTCCGAGGTGAAGGGGTTCGTGGAATCCCTCATGAACGAGCAGCTGGCGGTCTTCCTGGAGGAGAACC
CGAAGATCGCCAAGGACATCATCGGCAAATCCATCGAAGCGGCCCGGGCCAGGGAAGCGGCCCGAAAGGC
CCGGGAGCTGACCCGGCGTAAAAGTGCCCTGGACATCTCCAGCCTCCCCGGCAAGCTGGCCGACTGCCAG
GAGCGGGACCCGGCCCTCTGTGAGCTCTATCTCGTCGAGGGTGACTCCGCCGGCGGCTCCGCCAAACAGG
GACGGGACCGGAAGTTCCAGGCGATCCTGCCGCTCAAGGGGAAGATCCTCAACGTGGAGAAAGCCCGGTT
CGACAAGATGCTCTCCTCCCAGGAGATAGGCACCCTGATCACGGCCCTGGGTACCAGCATCGGCAAGGAA
GACTTCGACGTGGCGAAGCTCCGCTACCACCGGATCATCGTCATGACCGACGCCGACGTGGACGGCTCCC
ACATCCTGACGCTGCTTCTCACCTTCTTCTTCCGGCAGATGCCGGAGGTGGTGGAGCGGGGGCACCTCTA
CATCGCCCAGCCGCCGCTCTACAAGGTGAAGCGGGGCCGCAAGGAGCTCTATCTCCGCAACGAGGCGGCC
ATGCAGGCTTACCTCCTGGAGGAGGGGACCGAGGATATGGTCCTCTTCCTGGAGAATGGCGAGAAGACCT
ACACCGGCAAGCAGATCATCCCGATTCTCAAGCAGCTGGTGGAGTACCGGACCATTCTGGACAAGGTGGT
GCGCAAGGGGATCAATGAGGAGCTCATCCGGGTCTTTCTGCGGCTCGGGGTCAAGGCCGGCATCGAGGAC
ATGGAGCAGCTGGTGCCGTACCTGGCGAACATCTCCCGGGTCTACGAGGGGGGTGATTCCAGCCCCCTGG
ACGACGGGCGGGCCATCGTGCGGCTCGGCAACCTCCGGATTGCCCTGGACCAGCACACTCTCGACATCAT
CGGATCCTACGAGTACGGGCTCCTGGCCGAAAGCTTCCGGAAGGTCAGGGAGATGTTCGGCGACGGCCGG
GCCGTGGTCTCCAGCGAGGGGAAGGAGCTCTTCGCCACCGCCATCGGGCTCGACCTCCTCTCCTTCTTCA
TGGACTCCGCCAAGAAGGGGCTCTCCATCCAGCGCTATAAAGGTCTCGGCGAGATGAACCCGGACCAGCT
CTGGGAGACGACCATGGAGCCCACCAACCGGACGCTCCTCCAGGTGAAGATCGAGGACGCCATCGAGGCC
GACACCATCTTTACCATCCTCATGGGAGACCAGGTGGAGCCCCGCCGGGACTTCATCGAGAAGAACGCCC
TGAACGTGTCGAACCTCGACATCTGATGACCGATATTAGTAATTATCCGAGGAAACAGAATGCTTGAACA
GACCCTGAACAAGACTGCCGTCAATATCGAAGACGAGATGAAACGCTCGTACATGGACTACGCCATGAGC
GTCATCATCGGCCGGGCCCTCCCCGACGTGCGGGACGGCCTGAAGCCGGTGCACCGGCGTTGCCTCTACG
CCATGTACGACATGGGGAACGATTACAACAAGCCCTACAAGAAGTCGGCCCGGGTGGTCGGTGACGTGAT
CGGTAAGTACCACCCCCACGGCGACACGGCGGCCTACGACACCATCGTCCGGATGGCCCAGGACTTCTCC
CTCCGCTACCCCTTGGTGGATGGCCAGGGGAACTTCGGCTCCGTGGACGGCGACTCGCCTGCGGCCATGC
GGTACACCGAAATCCGGATGGAGCAGCTGGCCCACGAGCTCCTGAACGATCTGGAGAAGGAGACTGTTGA
CCTGGGGTTCAACTACGACGGCTCCCTCACGGAGCCGCTGGTGCTCCCCTCCAAGTTCCCGAACCTCCTG
GTGAACGGCTCTTCGGGGATCGCCGTCGGCATGGCCACCAACATCCCCCCCCATAACCTCTCGGAGGTCA
TCGACGGGATCATTGCCACCATCGGGAACCCGCACATAAGCTTCGAGGAGCTCCTGGCCCTGGTCCCCGG
TCCCGATTTCCCCACCGGCGGGTTCATCTACGGCCGGGAGGGGATCCTCCAGGGGTACCGGACCGGCCGC
GGCATCGTCCAGATGCGAGCCCGGGCCAGCATCGAAACCCACAAGAAGACCGAGCGCCAGTCCATTGTCG
TCACCGAGATTCCCTACCAGGTGAACAAGGCGAACCTCATCACCAAGATCGCCGAGCTGGTGCGGGAGAA
GAAGCTGGAGGGGATCAGCGACATCCGCGACGAGTCCGACCGGGACGGGATGCGGATCGTCATCGATCTC
AAGAGGGACGAGAATCCCCAGGTGATCCTCAACCACCTCTACAAGCAGACCCAGATGCAGACCTCCTTCG
GCATCAACATGCTCGCCATCGTGGCGGGACGGCCGAAGGTCCTGACGCTTCAGGACGCCATCGGCCACTT
CATCGACCATCGCCGCGAGATCGTCACCCGGCGCACCATCTTCGATCTCAAGAAGGCCGAGGCCCGGGCC
CACATATTGGAAGGCTACAAGATTGCTCTCGACTGGCTCGACGCGGTCATCGAGCTGATCCGGGGGTCAA
AGACCCCGGCCGAGGCCCGGGAAGGGCTCATGTCAGGCCTCTTTTCCGACGAGGAGTGGCTCCAGAAGAT
GGGGCTCCCCCTGCCGGCCATCCACAGCCAGTACCAGAAACCGGTGCGCCTCACCGAGGTCCAGGCCCAG
GAGATCCTCAACCTGCGGCTCCACCGCCTCACGGGTCTGGAGCGGGACAAGATCCTCCAGGAGTACGAGG
ACATCCTCAAGTACATCGCCCGTCTCAAGGAGATCCTCGCCTCCGAGGCGGAGATCCTCAAGATCATCGT
GGGAGAGCTGCGGGAACTGAAGGAAAAGTTCGGCGACGAGCGCCGCACCGAGATCGTGGACCGGAGCGCC
GAGATCTCCCTGGAGGACACCATCGTCGAGGAGGACGTGGTGGTCACCGTCTCCCACACCGGCTACATCA
AGCGGACCGCCGTCTCCCAGTACCGTTCCCAGCGCCGGGGGGGGAAGGGGAAGACCGGCATGAAGACCAA
GGAGGAGGATTTCGTCGAGCACCTCTTCGTCGCCTCCAGCAAGGACTTCATGCTCTTCTTCACCGACGCC
GGCAAGGTCTACCAGATCAAGGTATACGAGATTCCCGAGGGGGGGCGCGCCACCCGTGGCAAGGCCATCG
TCAACCTCCTGAACCTCCAAGAGAACGAGCAGATCACCGCCATCCTCTCGGTGAAGGGGTTCGACGACGA
GCGAAACATTCTCATGGCGACCCGCCTCGGGGTCGTGAAGAAAAGCCCCCTGCGGGAGTACGCCAACATC
CGGAGCGGCGGGATCATCGCCGTGAACCTGGACGAGGAGGACAAGCTCATTGCCGTGGCCCTCACCGACG
GGCGGCAGGACGTACTCCTGGCATCCAGGAACGGCAAGTCGATCCGCTTCCACGAGGAGGACGCCCGTCC
CATGGGGCGCGTGTCGCGCGGGGTGCGGGGAATGACCCTGGAGGACGACGACGTGGTGATCGGCATGGAA
GTCATCAACCCGAGCGCCACCGGTTCAACCATCTTCACTGTCACCGAGAACGGCTTCGGCAAGCGGACCG
AGCTGGACGAGTATCGGGTCCAGTCCCGGGGGGGCAAGGGGATCATCACCATCAAGACCACCGAGCGCAA
CGGCTGCGTCGTGGACATCATGCAGGTGACCGACGAGAACGACCTCATGCTCATCACCGACCAGGGGAAG
ATCCTCCGGATACCGGTGGCCCCCTTCTCGGTCATCGGCCGCAACACCCAGGGGGTCAGGCTCATGACCG
CCGAACAGAACGAGCGGATCGTGGCCGTAGCCAAGCTGGCCGAAAAGGATGAGGGAGATGAGGGGCCCGA
CAGCGGCGATGACCTTCCCGAGGCGGAGGTTGTCGAGGAGTAGCCGCGACGGACAGCGGCCCGAGACCGG
ATGATGCGTATTTTCCGGCCGCGGGTCCCTGGTCCCCGGTTCCCGCCTATGAAAAGTAATCGCAGCATCG
ACACGAGCCTCCGGGAGCGCCACACGATCCTGAACCTCCTGGAGGAACTGACAAGAGAGACCGTCACCAC
CGACGAACTGACCAGGATCGGCACCACGCTAAGGGCGGCGGGACGCCGGGCCCTTTCTCCCCTCTTCCGG
CGCCTCTGGCGGGAGAAGAACGAAGCGGTCATCTCCCGCTACACCACGCTCCTGAGCTTCTTCGAGGATG
ACGGGTGGCTGGAGCAGCTGATCCAGGTGGCCCTCACCCGGAAGGACTTGGAAGGACCGGCCCGGTCGGC
CCTCATCCAGGCACTGGCCGGCTATGGGGTGGACGTGTCAGCCCCCCCCTTCGCCCAGGCCGTGGACGGG
AGCGGAGGCTCCCTTCGGCTTGCGGTTCCCCGGCTCCTTGACCGGGGGGAGGAAGGGCTCATCGTTTTCA
TGGAGGAGTTCGCCGCTTACGGCCTGGAGGCCCAGAAGGCCATCGTCCGGGAGCTTTGCTTCGTGGACGA
CCCCCGGGTGGTGGACCTCTTCGGGGTCCTCCTGGCGTTTGACGAGCCGGATACCCACCGGGAGATCATT
GAGACCCTGGGGAGGGTCAGGTTCCCCGGGGCTGCGCGTCTGCTTCGGCGTTATCTGGCCGAAGCGCACG
AAGAGCACCGTTCCCTGGCCGAGCGGAGCCTGCGGAGGCTGGGGTTCCTGGGGGTCGACGCCGGCGACGG
CGGGGCGGAACCGCAACTGCCGTTCCATGCCACGTGGGCGAGTCCCCCCGATGCAGCAGGACTCAGCTGC
CTCCTGGTGGCACGCTGGACAGCGTCCAATCGTCTCGACGTTCTCTTCATGGAGCTCCACGAGACCGACG
GGATGCGGGATGCCTGGGGATGGAGCGGCCTGACGCCGGACGAATACGGGGATATCGTGCGGGAAAACGC
CGTGGAAGAGACCCTGGTGGCGGTGGACCCGGGCTACGCGGCCGATCTGATCGGGGATGCCTTGGAGCGG
AGCCACGCGAGCGGCTTCTACCTCCCCCCCGAGTTCTACGTGCGGCAGCGGATCCTGTCGGGGCTCGACG
TGACCCCGCGCCCCTACGTCCCCTCCTTCGGGGGGATGGAACTGGCCGGGGCAGACCGCCCTGATGTGGT
GGCCGGGAGCGCCGGGCTCCTGGACGACTGGTTCTTTGACGGCTGGTTCTTCTTCGACAGCCGGACCCGG
CTTCTGGCCGACGAGCTGGAGCGGTTCGGCGACGAACCCTTTGCCCGGGAGGACGAGGCGGCCGTGGACC
GGTTCCTGGAGCAATGGTGCAGCCAGGAAGTGGCCCCCCGCTTGGAGCGGATCGTCCGGCGGCTCTTCCT
CACGGCCGACCTCATGGTCCGCGCCGGCCGGGAGGAGCACCCGGTGGCCCAGACCGTGGCCTGCGCGGTG
AGCCTCTCCCGGGGGATCATCCCCCTTCACCGGCACCCCTTCCTGCGGCGCTGGCTCCTGGAACTGATCG
GCATGGTCCGGGAGGCCCGGGCCGAAGGGTACCAGTTCCCCCCCACCCCCTGGGACGACGAGGATGGGGA
GTGGGATTAAGCGCAAAAGCTATTTGAAACACTGAGCAACAGAGCAACGGAGTAAAATCTGAGAAACAAA
CCCTGAAATTTTAATTGATTGCATTAGTAGGGAACAGGCAGGATGTTTCGAAAAAGGGTGTTTTCTCAGT
TGCTCAGTTGCTCAGTTGCTCAGTGTTATTAGTTGGTTAACTGTTGAGTGCCACGACATCGTGGACAACT
TTTTGTGCCATGACATCGTGGACACTCATCTGAATCACCGCAGTTTGTAATCGAATTCCTCGACCTGATT
TTTATCCAGGAAGAGTTTCAGTTTCTGTTCTTTGACATCGATAGTCGCCACCACGTATTCAAGCGCTGTC
TCCGGTGGAACCGAGAAGCATTCGCCGAAGATGTTCAGCTTCAGGTCACTGCGGATAAGGCGGACAGCAT
GATATTTTCCGACTTCTGGCTTCTTCAGGCGATGCCTGGGAGGTTCATCCTCAGTCGGGAACCTCAGTTG
CACATGCGAGGTGGCCAGTGCTTTCAGCGGCGTACTCCCCTTTAGCTTGCTGTAGCGATACTTGCTGTTG
TGTCGCTGCTCAAAGGTCAGTGAGCCGACTTTCAATTCCTCTTCTGAAGTCATGATGACTTTGCCGAGGA
ACCGTTGTTGGTACCGGTCGTTGAACTTTTCGATCATGCCGTTTCTCCATGGTTCAGCCATGGGTATGAA
CCATGGTTCGACATCGTTATGCAGGCAAAGACGAATCAGTGGTCCCATGCCGCGGGGATGTGTCGGGCTG
CCGAAGAATGACATGGCATTGTCAACCTGGAGTCGTTCTGGGATGCCTAGTCGTTTCCAGACTTCCCACA
AACCGTCAATGACCATCTGACCAGCTTTGGACCGAGATGAGTGCAACCCGCACCTGACGGTTGCTGTATC
GACAACATTCAGGCTGTAGAAGCGAATTGGCCCTGTCAGATAGCATGGACCAACGAGATCAGCTTGGTGC
GTCTGGTTCGGCAACGCTGACGGCAGAACTGGGTAAAGCGTCCCTTTGGCTTCGTATTTGCCGGTGCGCC
GATGTGTCAGTTCATTCCTTGCAAGAATCCGATTGATGGTTCTGGTAGAAGGCAACGGCTTGACACCCAG
GTCCTCCAACTCCCACAGGATGGCCTGTGCACCACAGAACAAGCCCTTGTTGTAGAGATTGAGGCGAACC
ATTTTGACGATTTCTTCAATCTCTGCCGTTGTACGGTTCGGCATGGATTGTGGGCATCGGGATCGCTCGT
CACTCCATACAGGGTCATCTCCATTCTGGCGAGCAACCCATTTGTATAGCCAGGAACGAGACTTGCCGAG
TGATGTGCAAATTGATTCCGGGGTTTCGCCGTTTCTGAACCGTTGAACGGCCAACACCCGAAGCTGCTTG
TTTTTATCTTCCATGAACACCTCCGAGTTTGATGTGGTGTTCACAGAATGCCGTGGCGACTATTCGATTG
TCAGAGAACTTTGTCTACGATGTGCTGGCACATTTTTCTGTCCACGATGTCGTGGCACTCAACAGTTAAC
AAACATGAGCGAGGGACTGTCCATGGGCGAAAAGATCGGAGTCATCGGCGCGGGGAGTTGGGGAACAACC
CTGGCAAATCTTCTGGCAAAGAAGGGGCTGGATGTCACCCTCTGGGCCTATGAGCCGGAGCTGGTGGCGG
AGATGCGGGCCACGCGGGTCAACACCCTCTTTCTCCCTGGCACGGAACTCGCTGCCGGCCTCGCCTTCAC
CAACTCTCTTGAGGAGGCGGCAGCGGGGAAAGATGTGCTGGTTCTCGTCTCCCCCTCCCAGGTCATGCGG
AGCGTCCTGACGCAGCTCGCTCCCCTCCTGAAGCCCGGGGTGACGCTGGTGAACGCTTCCAAGGGGATTG
AGCTCGATACCCTCATGACCATGGACCAGGTATGCGGCGCCGTCCTCCCCCCCGCAGTCGCCGGACGCTT
CTGCGTCCTCTCGGGCCCAAGCTTTGCCCGGGAAGTGGCCCAGGAGATGCCGACGGCGGTGGTGGCGGCC
TCCGCCGACCTCGAGGCTGCGGCCCAGGTCCAGCGCCTCTTCACCGCTCCCTATTTCCGGGTCTACACCA
ACAGCGACGTGGTGGGGGTCGAGATCGGCGGGGCCCTCAAGAACGTCATCGCCCTGGCCGCGGGGATCTC
CGACGGCCTGGGGCTCGGCCACAACACCCGGGCCGCCCTCATCACCCGGGGGCTCGCCGAGATGAACCGC
CTCGGCCGCGCCATGGGGGCGGATCCGGCCACCTTCGCCGGGCTTGCCGGCATGGGGGACCTGGTCCTCA
CCTGCACCGGCGACCTCTCCCGCAACCGGACCGTGGGGATGAAGCTGGGCCAGGGGATGCGCCTTGCGGA
GATCCTCGGTGAGATGCGGATGGTGGCCGAGGGGGTGAAGACCGCCGAGTCGGCCTGGCGTCTTGCCAGC
CAGATGGGGGTCGACATGCCCATCACCGAGAAGGTCTACCAGGTGCTCTACGAGGACAAGCCGGCACGGC
AGGCGGTCCTTGAACTCATGACCCGCGACCCGAAGGCCGAGCGGGGGTAGGAACCCGAGTCCCCACACCC
GTCGGAGGGTATGCCATGAACCTGCGCCTCACGATCAGGAACAAGCTTTTTCTGGCTACCCTCCTCATTC
TCTTCATCTCCTACGCCATCCTTATCCAGACAACCGTCACCAGCATCAACACCTCCCTTGAAGACAACCT
GGCCAAGGAACTTGCCGAGAACCTCCGCTACGCCAAAGACCAGTACTTCTCCCGGGCAGAGCACCTGAAG
TACGCCCTCCTCCTCCCCGCCTCCGCGCAGACGGTGCAGGAGCGGGTCGAGAGGAGGGACAGGGTCTGGC
TCCAGGAGACGGCGCGGCGCTGGAAGACCAGCCTCCCCTTCGCTGAGCCGTTCCTCTTTGTGGACCCGCA
GCTGAAGGTCATCGCCGGCGATGGCGAGTCGGTGCCGGAGAATGTCCGCGAACTGGCTCCCATCGTGGAA
CGGGCGCTGCGGGAAAAACGGCCCGTTTCCGCAACCGAGCTGGTGAGCGACCGTTTCCTCTGCAGCGCCG
GGGTCCGCGACTTCTGCTCCCGTCCTCCCTACGGAGACGGGAGCGTCATGATGATAACCGTCGTCGTCCC
GGTACTGGCCGAGGGGGGGGAGGCCCTGGGCGCCATCGTGGCCGGGGAAGTCATCGACCGGGACGTGAAG
CAGGCGGCCGGGACTCAGGAGATTTTCGGCAAGCAGGTGGTTGTGGCCGTCATCCGTGGCAATAGGCTTG
CCCCGGCCGGCGTCAATCCTGCCTTCCCCTACCCTGCAGCCATCGCTCCCGATATCCTCGACAAGCTGGA
GCGGGGGCAGTCGTTCGGAGGCGACGTCACCATCGGGGGAAAGGCCTACAAGACCGCTATCTCACCCCTC
ACCAACAGCCGCGGAGACTACGTGGGTTCCCTCTACGTGGCCCTCTCCCGGGACGATTTAAAGGGGATCC
TCGGCGACAGCCTCAAGAATATCCTCGTATCCGCCGCCATCGGCATCGTCCTCACGTTTCTGACGGCCTT
CCACGTGGCCCGCAGGTTGACCATGCCCCTGAACGCCCTTGCCGGCGGGGTGCGAAAGATCGAGAGCGGG
GACTTGCGGCAACGGGTGGAGGTAACCACCGCCGACGAAGTGGGAGAGTTGGGAGAAGCCTTCAACCGCA
TGGCCCGAAGCCTGGAGGAGCGGGACCGGACCATCCGGGCCACGGCCCACGAACAGGCGGAGCTGAACCG
CAAGCTCCAGGAGATGAATGAACACCTCGAAGAGAACGTGAGCGAACGGACAACAGCCCTGCAGATGGAG
ATGGGGCGTCTTGAGGCGATTCTCACCGGCATGGCTGAAGGAATTGCCGTCACCGACCGGGAGGGGAAAG
TCATCCTCTTTAACCCCGCGGCCCAGCGGATCTTCGAGATGGTTCCCCCCCGGGTAATGGGGCATACCCT
GGAGGAACTCTGTGCCGGCGGAGAGTTCTGTGCCCTCGCCGATTACGTCCGCACCATGAAAGAAACCGAT
GACTTGACCCCCCGCCGGGACGTGGAGATGTCCATGAAGGGGAAGAAACTCACGATCAGCCTTTCACCTT
TCTGCGACCAGGGGGGAGCCTTGGCCGGCGTCGTCATGTCGGTGCGCGATGTGACCGGGGAAGAGGATGT
GGATCGGGTGAAGACCGAGTTCATCTCCACGGTGTCCCATGAGCTCAAGACCCCCCTCACCTCCATCAAG
GGTTCGCTCCAGTTCATCCACGACCGGGGGGAAGGGTTCGGCGGGATGGAGGGGGAGCTTCTCTCCGTCT
GTCTCCGTAACACCGACCGGCTGATCCGGCTCGTGAACGATATCCTCGACATTGCCCGGATCGAATCGGG
GCGGCTGGAGTTCGTGCCGGAGCCCCAGGATGTGCGGACCCTGGTCACCCACTCCATCGAGGAGCTGGCA
GGGTACGCTCTGGAGCATGACGTCAGCGTCGAGAACCGCTGTGGCCAGGACCTCCCCCCCATCTATGGGG
ACCGGGACCGTCTCGTGCAGGTTCTCACCAACCTCCTCTCCAACGCGATCAAGTTTTCACCCCGGGGGGA
ACGGGTGGTGGTGACGGCGGAGCGGACTTCAAACTACGTGGCCATATCCGTGGGTGACCGGGGACGGGAG
ATCCTGTGGTCGGATCGGGGGAAACTCTTCAAGAAATTTCAGCTGCTCGACAATTCGGACCGCCGTCAGC
ACGGCGGGACGGGCCTTGGGCTTGCCATTTGCAAGGAAATCGTCGAACATCACCACGGCAGGATCTTCTA
CAACGAAGGGACCGGGGGGGGGAACGTTTTCACCTTCACGGTTCCCGTCTATGAGGAACAATCATGAATA
ACCTCAAAATCCTCATCGTCGATGACGAAGCGGACATCGCCCTCATTCTCAAGCTGCAACTGGAGGACGC
CGGCTACCGCACCACCCGGGCCCGGGATGGCCTGGAAGCCCTGGAGATGCTGGCCCGGGAACACTATGAC
CTGATTCTCCTGGACATCCGCATGCCCCGCCTGGATGGCATTGAGGTGCTGGAGCGGATCCGGCAGGAGT
GGCCCGAGCTGGTGGTGGTGATGATGACTGCCCACGGCAGCGAGGACATCGCCGTTGAGGCCATGAAGAA
GGGGGCGGTGGACTATATCTCCAAGCCCTTCTCCTCCGATGATATGAAGAAGCGGGTGGAGCGGGCCATC
GAGTACAACCGGACCCGGCTCGAAAACGAGCGGCTCCAGCGGGAGGTGGAGGAAGAGCGCCGGAAGATGG
AGGCGATTCTCCAGGGGATGGCCGAAGCCCTCGTGGCCGTGGACCGCCAGGGACTGGTCATGAGCATCAA
CCGCACTGCCGCGGAACTTTTCGGGGTTGATGCGGCCGCGGTCCATGCCCGCCCCGTGGAGGAACTCCTC
TCCGCCGCCATCCCGGCCGACCGGCTCCCCTGCCGCGTGGTGCTCGCCACGGGAGAGCCGTGCCTCGACG
TGGCCTACGACCTCCGCCTGCCGGGCCGGATTGTGCCGGTCCTCTCCAGTGCCGCCCCCCTGGCGAACGC
CGCCGGCGAGATGATCGGGAGCGTGGAGATCATCCGCGACATCTCGGCCCTCAAGGCCCTGGAACAGGAG
CGGGAGGATTTCGTCAGCATGCTCTCCCACGACCTGAAGACCCCCATTACCGCCATCATCGGCTCCATCG
ACCTGGTGAAGGAGGGGCGGCTCGGTCCAGTGAATCCGGAACAGAGCATGTACCTGGACGCCGCCGTGGA
GAGCTGCGCCGAGATGGTGGACATGATCGACACCCTGCTGGATGTGCACCGCTTCGAGGCGGGGCGGATG
GTGACGACCCTTGTGGAAGAAGAGCTCGGGCCGCTCCTGCAGCGGACCGTTGGCAGGTTCGAGCCGGTGG
CCCGCCACAGCGGGCTCGAACTTACCCTCTCTCTACCCGGCGCTCCAGTCACCTTCCTGGTGGACCGGAA
GCAATTCGGGCGACTCCTGGGCAACCTCCTCTCCAACGCCCTGAAGTTCACCACTGAGGGCGGCATCGAG
GTACGGGCGGAGCTGCCGGAGAACGCCGCGGCGGCCGCACAGGGGATTACCCCCGGCGCCTACCCGACCG
AGAGACTCCCCCGGGAGGGACGATACCTGCTCGTTTCGGTGAGCGACACGGGGGCCGGGATTCCGGCCGA
TTCCCTCGTCACCATTTTCGACCGCTTCGTCCAGGCCCGCAACCGCAAGATGGGGAAGTCGAGCGGCACC
GGGCTCGGGCTCGCCTTCTGCCGCAAGGTCATGGATGCCCACCACGGCTTCATCTGGGCCGAGAGCGAGC
CTGACAGGGGGAGCACCTTCCGGATGCTTTTTCCGCTGGGGACCGACTGACCACTGAGCGAGGGAACTTC
GCCCATGAAACTGCCGTACCACACCATGCCTTTCAGGATCGCGGCGTACTATGCCCTCTGTGCAGGGCTC
TGGATCCTCCTGTCCGACCGGCTCCTCGGGGTTGCCGTTCGGGATCCCGACCTCATCACCAGCCTGGAGA
CGGCAAAGGGATGGCTCTTTGTGGCGGTCACCGCCCTCCTCCTCCATGTGGTGGTCCGGCGCTTCGTCGA
TGAGGTGATGCGCCGGGAGGAACTTCTGCGGGAGCGCAACGAAGAGCTCTGCATGGTGGAGGAGGAGCTC
CGCCAGCAGCTGGACGAGTCCGAGCGGGCCCAGCAAGAACTGCGGGAGAGCGAGGAAAACTACCGGCTCC
TCTTTTCGAGCAATCCGCATCCCATGTGCGTTTTCGATCTGGAGACCCTCGCCTTCCTGGAGGTGAACGG
ATCGGCTATCCAGCATTACGGATACAGCCGCGAAGAGTTTCTTGCCATGACCATCAAGGACATCCGTCCC
CCCGAGGATGTGCCGTCGCTCATGGCTATCGTGAAGCGGGTCGACAGCGGGCCTGACCGGGTCGGCGTTT
GGCGCCACCGGAAAAAGGACGGCACGATCATCTCCGTGGAGATCACCTCTCACATGATCGATTTCGCCGG
AAGGCGTGCGAAGGTGATTCTGTGCAATGACGTAACGGAGCGGATCAGAGCGAAGGAGGAGATCCTGCGA
CTCAACGCCGAGTTGGAGCAGCGGGTGCGGCAACGGACCGCGGAACTGGAGCAGGCCAACCGGGAGATGG
AGTCCTTCAGCTATTCCGTTTCCCACGACCTGCGGGCGCCGCTACGCCACATCGACGGGTTCAGTCGGGT
GCTTCTGGAAGACTGCGGCGACCAGCTCAATCAGGAGGGAAAGGGATACCTTACCCGGATCTGCGCCGCT
GCCAACCGGATGGGGCAGCTCATCGACGATCTCCTCCAGCTGGCCTCCGTGAGCCGCAGCGAACTGCAAC
GGCGCCCCGTCGATTTCAGTAACCTGGCTCGGACTATAGCCTTGGAACTGAAGCAGACAGACCCGGAGCG
TGAGGTTACCTTCACCATTGCCGGGGGGGTCAGCGCTCAGGGAGATCCCGTCCTCCTGCGGGTCGTGCTG
GAAAACCTCCTGGGTAACGCCTGGAAATACACGGGGAAGAATCACCGCACCGCAATCGAGTTCGGGGCAG
TCGAGGGGGAGGAGGGACGGGTCTACTTCGTGCGGGATAACGGGGTCGGCTTCGACATGACCTACGTGGG
CAAGCTTTTCACCCCCTTCCAGCGGCTTCACGCCATGGACGAGTTCGAGGGAACCGGCATCGGGCTGGCC
ACGGTGCGCCGGGTGGTGGAACGGCACGGCGGGCGGGCCTGGGCCGAAGGGACAATCGGCGCCGGCGCCA
CCTTTTACTTTACCCTGGGAGAATCTCACCGCCTTGCGGAGGGCGACGAAGGATAAGCGATGGACGATTT
GCACCTGAGGATACTGCTGGCGGAGGACTCCGAGGAGGATGCCTTTCTGCTTCTGCGGGAGCTGGAACGG
GGGGGATACACGGTGGAGTGCGAGCGGGTGCAGACCCGCTCCGCCATGAAAAAGGCCCTGGTCTCCCGGC
AATGGGACATGGTCATTTCCGACTACCGGATGCCCCGGTTCTCCGCGCCCCAGGCCCTGGAAACCCTCAA
GGAGAGCGGTCTCGACCTCCCCTTCATCATCGTCTCCGGCAAGATCGCCGAGGATATGCTCGTGGATGCC
ATGCGGGCCGGCGCCAACGACTACTTCATGAAGGGGAACCTGTCGCGGCTCATTCCTGCCATCGAGCGGG
AGCTGCGGGAGGCTGCCGAGCGGCGCATCCGGCGCCGGGCCGAGCGGGCCATCCGCCAGGGGAAAATGGA
GTGGGAGGCGGCTTTCGACGCCGTGTCGGACCTGGTCCTTCTCACCGACCTCTACAGCACGGTCATCCGC
TGCAACAACCGGGTCATCGAGGCCTTCAACGCCACCTACAGCGACATCCTGGGGAGGAACATCACCGAGC
TTTTCTACGGCAGCCCCGACGCCGGGGAGAGCATTTTCGATCAGTGCACCGATCTGAAGGCCGATAACGG
CGATGTCCGCTTTCCCAAACTCACGGGATGGTACAAGGCCTCCTGCTTTCCCATGCACCCTACCGAAAAC
GAACACGGCTTCGTCTACGTCATCAAGGACGTCACCAAGCGGAAAAAGATGGAGGAAGAGAAGGAGCTGG
CCACCCTGGAGCTTCTCCGGAGCCGCCAGGCCCTCAGGGAGAATCTGGAGGAGATGAAGCGGGCCAACAT
GGAGCTGGGGCGCCTGAACGCCGCCAAGAACACCGTCATCGGCATGGCCTCCCATGAACTGAAGACCCCG
CTTACCTCCATCATCGGTGGGCTCCAGTTTCTCTTCCACTACAGCGGCCTGGAGATGACCCCGGAGCAGA
AGGAGATGATGGAGTCGGTCTACGAGGGGGTGACCCAGCTGCGGGGGATCGTGGACGATCTCCTCTCCAT
CTCCCGCATCGAGACCAAGGGATTCGCCGTCACCAAGCGGATGGTGAACCTCCTCAATCTCTGCCGGGAG
GTGCGCCATACCCTGCTCCTTCCCCTGTCGGAGCGGGACATCGAGCTCTCCATTGCCGAGGACACCTGCA
GCATTCCGGCCGACGAGGGGTTCTGCCGGCTCGTGACCCGGAACCTCCTGGAGAACGCCATCAAGTTCAC
CGCCGACGGGGGACGGATCACCATCAGCGGCGAGCTCACCTCCCTGGACG