Aedes aegypti cytochrome P450s


Oct. 18, 2005 under revision April 21, 2006 (in progress)

Revision continues May 19, 2006 to June 25, 2006

Compiled by David Nelson and David Drane


The completed and named sequences are here


This file is more archival with detailed information.

Please see the FASTA file above.


Useful links for analysis  Trace Archive at NCBI Trace files at Ensemble P450 Blast server Do-it-yourself WU Blast DNA translator   NCBI TBLASTN search NCBI megablast TIGR Aedes gene index page


206 Aedes sequences here including 142 complete sequences. 

Numbers in () are intron phases. Names have not been assigned for most genes.


Sequences collected and assembled by David Drane and David Nelson from July to Sept.

2005. 3.5 million of 15 million trace file sequences were downloaded from NCBI and

placed on a stand alone BLAST server on a Mac G4 for TBLASTN searches

at expect value of 10.  The WGS section of Genbank was searched and 220 AAGE01XXXXXX

accession numbers are given at the end of this file.  The TIGR Gene Index was

searched for text “P450”.  The EST section of Genbank was searched and

discontiguous megablast was used to extend sequences by chromosome walking.

Most sequences should be represented here now, but not all are assembled. 

The Aedes mosquito seems to have more P450s than the Anopheles mosquito. 


This file is in progress.  The CYP4 and CYP325 families are not yet fully assembled

because there are some large introns in these sequences.

The sequences are presented in clan groups: the CYP2, CYP3, CYP4 and mitochondrial

clans.  Note: Aedes has a CYP18 that was not found in Anopheles.

CYP329 of Anopheles now looks like it is a pseudogene of a CYP9 sequence.

It is short in the heme signature and it has a P at the critical T in the I-helix

oxygen binding pocket.  It is the only sequence that is in the CYP3 clan that does not

fall inside the CYP6 or 9 families in Anopheles.

There are 11 complete sequences in the CYP2 clan (CYP15, 18, 303, 304, 305, 306:phm, 307)

Phantom phm is one of the Halloween genes.

There are 76 complete sequences in the CYP3 clan (CYP6, CYP9)

There are 34 complete sequences in the CYP4 clan (CYP4 , CYP325)

There are 9 complete sequences in the mitochondrial clan (CYP12, 49, 301, 302:dib,

314:shd, 315:sad) These include three of the Halloween genes disembodied dib, shade shd,

shadow sad.

There are 21 pseudogenes so far.

There are 15 partial sequences (not including the pseudogenes).


CYP2/CYP18 clan sequences


>514720743 753475610 750240311 possible CYP15 N-term = DR747015.1 EST



>CYP15B like 585964866 641740723 584363040






>CYP15B like seq DR746695.1 adult female corpora allata cDNA

813859354 749484786 522065275 514869301 520643713







>possible complete CYP15B1 assembled from parts 52% to 15B1 from Anopheles

AAGE01116789 AAGE01129498

Used trace archive seqs to verify seq at PLLNLLRPLWTFLQ

This region is not accurate in AAGE02003241.1







used AAGE02003241.1 for the C-term seq changes












>567527404  46% to CYP15B1 may be a CYP15 pseudogene





>CYP18A1 AAGE01025833 AAGE01338874.1 AAGE01065191.1 529463664 572557122

66% to 18A1 (note: CYP18 not seen in Anopheles) complete

revised at cyan aa based on AAGE02007615.1













1756 ADLDRLRNVGSC*  1718


>AAGE01098313 (upper seq) CYP18 like fragment probable pseudogene

Query:  1703 ASLNEVGSRSS 1671


Sbjct:   210 ASLNEVGSQST 220










Query:    56 AYLDEILKAQAE 21

             AYLDEI KAQAE

Sbjct:   322 AYLDEIQKAQAE 333


>AAGE01227048 (upper seq) CYP18 like fragment probable pseudogene













>CYP303A1 AAGE01109944 641807020 834983680 618119317

834966118 826136105 587934965

72% to 303A1 complete











>581536484 803281860 586608108 826028980

574131458 595148561 754352758 590136340 519840563 753671460

67% to 512982119 above 58% to 304B anoph

tried walking the chromosome down to exon 2 so

some numbers above are in the intron






>223483644 519671636 528946489 494183870

a second 304B like C-term sequence 57% to 304B








>CYP304B2xx Possible full length gene joining the 512982119 and 223483644 fragments complete

note this is a hybrid of two different genes, see corrected seq below













>CYP304B3yy/xx top part = my old Byy, bottom = my old Bxx + 1 aa diff

DW987682.1 EST supports this assembly, so mine are hybrids

AAGE02028825.1 revised seq on 4/20/06












>512982119 637789748 834948129 570603901 750442192 570627554 568540398

743856885 581525309 637183809 812171267 586112683 570800380

579961153 793213948 581533371 587665129 570695804 574007683

60% to 304B1anopheles numbers above include a long chromosome

walk of about 5-7kb, about 500 bp per step.  No C-term was found

N-term exon is 55% to 304B anoph. and 48% to 304C anoph.






>CYP304B 494544931 512720460 41% to 476322188 72% to 304B1

827562306 594336057 512633341









>CYP304Byy AAGE01029809 Possible full length gene joining

the 581536484 and 494544931 fragments complete

note this is a hybrid of two different genes, see corrected seq below













>CYP304Bxx/yy top part = my old Bxx, bottom = my old Byy

AAGE02028825.1 revised accurate seq 4/20/06











>CYP304C1 AAGE01104491 512990636 572473586 613989430 64% to CYP304C1

749978894 754492027 584954719 complete













>CYP305A6 AAGE01041187 494160882  476322188 754462117 mate pair = 754369970

which is an exact match to part of AAGE01202372

65% to 305A2 825745101 613940462

AAGE01202372.1 N-term exon for CYP305A complete

















13391  LGITFTDGPFWTEH  13350







12269  YKVVFEPRLK*  12237


>73% to CYP305 above 519967093 521924636 570423900 pseudogene of AAGE01051792

contains a deletion and stop codon








AAGE02003240.1 this matches 305A5























>CYP305A5 AAGE01051792 70% to CYP305A2 but no stop codon N-term exon is one of two choices.

82% to other CYP305 Aedes seq

520611721 836008963 529076567 570690021

AAGE01309663.1 CYP305A N-term exon matches by default since the other CYP305 has an exon 1 sequence complete












>CYP306A1 570772008 512981304 597667916 641824294 753304856 593374976 574131373

587966306 514783872 514783871 618134500 835036042 803206894 578828539

AAGE01228356 AAGE01635404 AAGE01635520 complete











>CYP307A1 571521703 817504746 824335840 591439033 834970143

TC53059 TC28026 TC50479 78% to CYP307A1 complete

813467047 (exon 1) found by searching with the DNA seq above, 67% to anoph 307A1













>CYP307B1 AAGE01081732 476411966 68% to 307B1 519649910 578920479 complete

revised according to AAGE02011086.1 and AAGE02028078.1 4/20/06












CYP3 clan CYP6 related sequences

Note CYP6 and CYP9 sequences (in Anopheles) have only one intron and will be the easiest to assemble. 6AG, 6AH and 6AJ

Are exceptions. 


CYP3 clan sequences

CYP6 related, 14 complete, 20 partials


>AAGE01198540 494152727 63% to CYP6Z2 67% to AY433537 519918984 574095157 569650597 complete












>AAGE01065173 78% to AAGE01198540

N-term is on AAGE02015843.1 (revised 4/20/06)











>AAGE01047841 AY433537 62% to 6Z2 569650597 622013821 579345058 complete













>AAGE01005406 80% to AY433537 62% to 6Z2 complete

possible pseudogene with frameshift at AVGDKLX X = ct

confirmed in four trace archive sequences

520668645, 757097876, 589569591, 811977620












>AAGE01054542 476413066 56% to 20199522 76% to 6Y1 579367130

614744104 834925676 complete







IN (1)





>AAGE01206812 586027460 593564617 637757183 494307621 complete 38% to 6M1

TC54189 TC23406 TC42024 38% CYP6P3 TC54190 TC23407 TC42025 TC574 TC6535

83% to TC63333 94% to TC54191 581543219













>617983543 some differences with TC54191 TC42026 44% to CYP6Z3

94% to 586027460

584131270 520119914 760257438 832454533 625082069

complete 39% to 6N1 anopheles complete












>NABNU08TR  NABNU08 32% to CYP6Z4 59% to 586027460

(no genomic match) looks like a pseudogene

best genomic match was to 617983543 at 77%

I do not think the TIGR database actually has an Aedes seq that is missing from

The 15 million trace files of Aedes, so this may be a contaminant from another









>AAGE01003592 512632636 TC63333 TC10785 TC15419 TC26904 TC37692 TC4101

41% to CYP6P4 83% to 586027460 836033925 753054225 574000494

(n-term looks identical to 586027460) complete

revised 4/21/06 used AAGE02004393.1, AAGE02030939.1













>CYP6AG3 AF288534 AAGE01003202 TC54102 TC12857 TC2905 TC29599 TC46955

TC9197 62% to CYP6AG2 48% to 6AG1 complete

Revised 4/21/06 used AAGE02011378.1 211773-218215 (+) strand













>CYP6AG4 possible assembled whole sequence 93% to 6AG3

NABUJ77TF = 6AG4  NABUJ77 = 6AG3 57% to CYP6AG2 90% to 6AG3

AY431873 96% to 6AG3 only 2 aa diffs to new 1.231_5

60% to 6AG2 only 45% to 6AG1 complete

DR747526.1 EST 95% to 6AG3 98% (only 3 aa diffs) to AY431873

This seq not found in the WGS section may be hybrid

Replace with













>AAGE01024260 51% CYP6AG1 complete

replace with AAGE02035807.1 1 aa diff to earlier version











>AAGE01002325 58% to 6AG1 complete


5361 DEIYR (2)










>AAGE01005157 51% to AAGE01002325 48% to 6AG1 complete












>AAGE01024111 86% to AAGE01002325 complete











>CYP6AL1v2 AY771597 AAGE01003622 complete 40% to 6N1, 98% to 6AL1

476388850 494541913

TC67380 TC35464 TC46198 98% to AY771597, 2aa diffs to 6AL1











>AAGE01116725 827542817 63% to 6AL1v2 complete











>CYP6AL2 AAGE01012031 494577102 622074403 641800960 755156422 632907779 580010239

42% to 6Z2 complete 51% to 6AL1












>AAGE01225620 AAGE01073711 84% to 6AL2 588918478 complete











>AAGE01005840 44% to 6AL2 810047144 637194488 complete











>AAGE01173027 TC56435 TC16115 TC27418 TC40206 TC8341 56% to CYP6N1v2

494318851, join with 223483845 complete

replace with AAGE02015839.1

note: ESTs DV300013.1 DV262803.1 have CVG not CIG at heme region











>AY433475 AAGE01031181 complete 52% TO 6M4 519940462 2246449 DR747763.1

821767964 627434636 90% to 6M5













>AAGE01032555 AAGE01493222 (4 aa diffs) 476379758 88% to AY433475

570738080 578795972 58% to 6M2 complete












>CYP6M5 AAGE01133741 494330821 73% to AY433475 578801721  826022155 639077358 760273799 581855956 complete












>CYP6M6 AAGE01004894 complete 476324109 637742538 512549238 568770347

5 aa diffs to 6M6 476418676 494093520 66% to AY433475











>AAGE01105997 63% to 6M6 822931992 complete












>476419050 52% to CYP6N3 637792107 793200622 complete

AAGE02015839.1 4/21/06











>AAGE01021887 66% to AAGE01005098 complete

replace with AAGE02015839.1 4/21/06











>AAGE01004071 494535013 complete 55% to 476419050 56% to 6N2

TC62330 TC28072 TC40767 58% to CYP6N2












>AAGE01078584 494579395 48%  to 581602077 46% to 6N2 586209056 568771938

574225739 pseudogene (sequence does not continue)











>AAGE01020246 79% to 494579395 58% to 6N1 complete












>AAGE01192518 80% to AAGE01020246 637742736 (758bp upstream do not have more P450 seq)

this break is not near the usual intron boundary CIN/ESLR.  This is a probable

pseudogene fragment.




>AAGE01052546 494130149 64% to 76419050 615888679











AAGE02018066.1 Length=351875 use this seq







318898  N (1)





>AAGE01005098 6263502207 69% to 6N2

TC55162 TC31642 TC43307 584989096 579853579 complete














>AAGE01273771 520199522  728739223 86% to CYP6N4v1 578623429 complete













>AAGE01504815 581602077 91% to CYP6N3v2 753204063 815151384 632872571 complete 579754790 TC62375 TC16009 TC23365 TC47533 TC56452 TC50555 6N6v1 6T1.4














>AAGE01026936 476398858 46% to 476419050 48% to 6N1 584294086 819690004














>AAGE01569058 TC56593 TC20604 TC28568 TC51124

56%  to CYP6AA1 834896125 complete











>223495136 AABUM55TV.gz 59% to TC56593 40% to 6aa2 pseudogene?

Sequence has no exact match, 78% to 615844728(TC56593 see above)





>AAGE01185776 223460790 57% to TC56593 53% to 6AA2 78% to 223468847

636165685 580089056 637123288 complete











AAGE02023125.1 Length=57153 use this seq probable allele of upper seq

97% identical 12 diffs







14210  VEQIVH (1)  14193





>223468847 73% to 223460790 I-helix and end 62% to 223460790 pseudogene






>AAGE01408667 TC66947 TC28477 TC49577 55% to CYP6P4 TC67159

TC33540 TC39062 593244050 519827477 50% to CYP6P4 complete

Revised May 15 2006, Trace files support the cyan seqs













>AY432230 AAGE01011017 52% to 6P4 583641208 589587999 CR937398.1

CR937850 CR937397.1 CR937849.1 complete










>AAGE01083421 476356097 39% to CYP6AD1 587854394 570810577 complete













These trace files match 100%  MISGTVCILLVLA















These trace files match 100%



































>1.1327_5 AAGE01083421 JP’s version 17 diffs to AAGE01083421, new gene



These trace files match 100%  MISGTVCIVLVLA









gnl|ti|591518206  this seq also matches JP’s version







Two different sequences exist









>CYP6Pnew 574331490 AAGE01337778.1 571589719 600552785 complete

66% to 6P4

note: TC66947 begins 357bp downstream of this seq, same oreintation

this seq matches AAGE02030882.1













>AAGE01395583 96% to 6Pnew 592239414 N-term part C-term part 569878875

803228481 a second C-term part, neither can extend 8 aa to the normal exon boundary

This looks like a pseudogene









this is the same as

AAGE02023125.1 100% match to 1.702_1 with error at intron boundary, missing small exon

This could be a pseudogene since the gene structure does not match related genes

The end of exon 1 could be broken off by an insertion, blocking expressed. 

If it is expressed it is missing 2 conserved amino acids VM







44758  GLRYLDNVVN (1) 44729





>AAGE01028822 752849490 633799995 600024515 576876673 complete 65% to 6S1













>AAGE01126587 45% to 6AJ1 missing part of exon 4 632860227 759657436 578977303

walked by megablast to AAGE01030106.1 but this still does not get the N-term

bset match to N-term in WGS = AAGE01034156.1  Since there is only one 6AJ

This must be the correct N-terminal.

Note after the sequence PERDDQLQSLLKTK there is a gap compared to Anoph 6AJ1

The seq KSSTY that comes right after this seq in 6AJ1 appears on the

Opposite strand translation in the same spot, so there might be an inversion

Here and this might be a pseudogene.  13 aa at the end of exon 4 are missing.

Five trace file seqs have a 100% match in this region, so the seq is correct.

Alternatively the seq may be shorter like 6AH1 or 6AG.  A PHASE 1 boundary is














>AAGE01171970 69% to 6AK1

822917241 578615327 575500950 complete














>AAGE01277917 65% to 6AH1

519656511 569678490  521887623 578889466 749413119 578997302 complete













CYP3 clan

CYP9J related sequences 17 complete genes, two full length pseudogenes

And two partial pseudogenes


>CYP9J1 TC67648 TC11677 TC2154 TC45358 AY064092 AF390099 complete 50% to 9J4 96% to 9J2 












96% to CYP9J1, 9J2, 9J15 complete

nearly identical to 9J2 (9aa diffs)

This is a near exact match (1 aa diff) to CYP9Jae9 below without any frameshifts

This is not a pseudogene















>CYP9Jae9 494315799 588882678 579665582 579009008

          Length = 536


 Score = 1060 bits (2742), Expect = 0.0

 Identities = 535/557 (96%), Positives = 535/557 (96%)

 Frame = +1










































AAGE02011007.1 1 diff to CYP9Jae9 (fourth P450 on this contig)


177640  SKLLYNSYPDAK (2) 177605











>CYP9J2 TC64859 TC11586 TC5014 TC50571 AF329892 complete

50% to 9J4

96% to 9J1, 98% to AY064093












>CYP9J15 AY064093 complete 98% to 9J2 50% to 9J4














>AAGE01172381 AAGE01048909 TC52199 TC17152 TC22373 TC36113 72% to TC60679

575142964 494348902 trace archive seqs

join with TC60874 TC20300 TC25446 TC48456

complete, 57% to CYP9J2, 57% to 9J1 56% to 9J15












AAGE02011007.1 Length=228841 use this seq part of a large gene cluster

With 6 genes and one pseudogene on this contig (second P450 on contig)

Others are at 143937 (+)=CYP9Jae7, 164192 (-) = AAGE01021462, 177820 (-) = 9J2, 196721 (+)= 9J9v1 (6 diffs), 218249 (+) = 9J10

220106 (+) pseudogene N-term exon 1 only new













>AAGE01021462 82% to AAGE01172381 821673483 574004088 637743693 complete

AAGE01075209 only 4 aa diffs to 574004088


398 QMMYNTYPDAK (2) 366












AAGE02011007.1 = old AAGE01021462 (third P450 on this contig)


164012  QMMYNTYPDAK (2) 163980










>AAGE01005986 476365476 825769964 631521475 578081381 476406576 591384997

51% to TC52199 59% to 9J3 complete











AAGE02011007.1 1 diff to AAGE01005986 (first P450 on this contig)


144111  NRFPNDK (2) 144131










>476384387 587659684 832450214 519879482 82% to AY433038 54% to 9J5 complete

note this seq is upstream of 9J6 on AAGE01000868 (4723-3066) on opp. strand












>CYP9J6 AY433038 AAGE01000868 (10298-11954) 520111339 528815988

616367213 644315757 56% to AY431970 56% to 9J5 complete












>AAGE01063458 263503628 49 % to TC52199  48% to CYP9L3 476324061 

DR747831 520184164 820336301 223394438 51% to CYP9J1 476322739 complete












>CYP9J9v1 AAGE01125862 AAGE01449675 TC60679 TC19466 TC24864 TC43056

59% to CYP9J1 AY431945 DR747470 91% to TC60950,

90% to TC60951 588932055 complete













AAGE02011007.1 6 diffs to 9J9v1 (fifth P450 on this contig)


196901  VKLLYNSFEGYK (2) 196936










>AAGE01065801 AY431970 60% to 9J5 494336054 641818007 578928176 complete

AAGE02029679.1 use this seq change D to E










>AAGE01006393 81% to AAGE01065801 83% to AY431970 complete

AAGE01400897 84% to AAGE01065801 834914646 N-term 578891344 C-term


569 QTIYNKFPGVK (2) 537











AAGE02029680.1 Same as above use this seq


86708  QTIYNKFPGVK (2) 86740










>AAGE01179692 AAGE01102574 AAGE01259804 (3 aa diffs)

476398393 616358813 575550118 584317339

67% to TC60679 in 9J fam

53% to 9J4 63% to 9J9 complete

AAGE01266366 parts of two genes













>AAGE01198792 (parts of two genes, 1-804 is N-term of AAGE01339434,

1707-973 is C-term of another gene) 95% to 476398393 

574155449 638535809 complete













>AAGE01102574 possible pseudogene fragment upstream of AAGE01179692

AAGE02011008.1 pseudogene piece


2086  GSRLALIEVKRM  2121



AAGE02011008.1  use this seq (first P450 on contig)

Note 6 P450 genes in this contig at 2k, 4k= AAGE01339434, 6k=9J8,

16k= AAGE01007189, 19k= CYP9LaeP 494089659, 31k = 9Jnew all (+)


2600  FPQAP (2) 2614











>AAGE01339434 AAGE01406122 775439256 579949790 521969711 complete 61% to 9J10

AAGE01266366 parts of two genes

AAGE01198792 (parts of two genes, 1-804 is N-term of this gene,

1707-979 is C-term of another gene 95% to 476398393) 

NABOD09TR  NABOD09 TC54929 TC20193 TC31509 TC43101 TC5368 TC8501












AAGE02011008.1  use this seq 6 diffs to AAGE01339434 (second P450 on contig)


4457  PESK (2) 4468










>CYP9J8 AAGE01187448 AAGE01142069 AAGE01118978

476375412 832374064 810104215 758886185 262894467 complete

AAGE01439874 N-term of 9J8 and C-term of AAGE01339434

9J8 is 609bp downstream of AAGE01339434












AAGE02011008.1 use this seq 4 diffs to CYP9J8 AAGE01187448 (third P450 on contig)


6749  FPNAK (2) 6763










>AAGE01007189 AAGE01035444 65% to 9J8 complete


2876 HTHPEAK (2) 2856











AAGE02029680.1 Length=88206 note 9 P450s on this contig, use this seq


12993  YHTHPEAK (2) 12970









11524  ELEPRERS*  11498


AAGE02011008.1 use this seq 1 diff to AAGE01007189 (fourth P450 on contig)


16844  HPEAK (2) 16858











>AAGE01004684 AAGE01021948 494089659 55% to CYP9L2 223518047 590305650 827533211

569625505 575383376 520166303 520595733 637720165 65% to 263503628 complete

possible pseudogene This seq has a stop codon seen in 9 trace files










AAGE02011008.1 Length=35048 use this seq both ours were wrong













AAGE02011008.1 use this seq 1 diff to AAGE01007189 (fifth P450 on contig)

pseudogene This seq has a stop codon seen in 9 trace files


20006  FPDAK (2) 20020









21434  EKGMHLRLKVRG* 21472


>CYP9Jnew AAGE01553900 AAGE01064689 59% to 9J5 644306108 757010867 616348285 complete AAGE02011008.1 (sixth P450 on contig)












>AAGE01123974 494309314 592077078 733946792 579386359 62% to CYP9J5

pseudogene N-term missing, deletion in second exon











>494345849 G719P81FE4.T0 pseudogene 92% to 494309314








>AAGE01253357 476363988 755013039 587425733 632907226 55% to CYP9J5 complete











>AAGE01015732 91% to 476363988 55% to 9J5 complete


2445 AYVYNKFPGVK (2) 2477










>AAGE01001411.1 3000-5000 region 10kb upstream of 9J7 complete











>CYP9J7 262902386 621799144 520524964 618123933 complete

AAGE01001411.1 13000-15000 region












AAGE02029679.1 use this seq


77676  DYVKTVYDSFPDAK (2) 77635









76236  LKMVPK* 76216


>AAGE01024220 39% to 9J8 40% to CYP329A1 anopheles 826166409

note has a P at I-helix T location like CYP329

There is a deletion and a stop codon in N-term exon

This may be the CYP329A1 pseudogene equivalent in Aedes

Change N-term to eliminate the stop codon






4653  YQKFENER (2) 4676











>CYP9J10 complete AAGE01039952 AAGE01005096 494160094 72% to TC52199

754334205 821634863 803206067 637185165 TC60951 TC32891 TC38518

57% to CYP 9J1, 90% to TC60679 98% to TC60950 (56% to anopheles 9J4)

CYP9J10 TC60950 TC38519 60% to CYP9J4 98% to TC60951 (3 aa diffs)

98% to 9J10v2 (2 aa diffs) 98% to 9J10v1 (3 aa diffs)











AAGE02011007.1 5 diffs to 9J10 (sixth P450 on this contig)


218429  LKMLYNTYEGSK (2) 218464










>AAGE02011007.1 pseudogene exon 1 new seq last P450 on this contig

168bp downstream of 9J10, 51% to CYP9Jae4


220286  LHFKKICVFFPDA  220324


>AAGE01088707 494098990 826090661 819721560 57% to 9J5 complete











AAGE02029679.1 2 aa diffs to AAGE01088707 use this seq


32328  QTLYDKYRGVK (2) 32349











>AAGE01194580 86% to 494098990 832396347 complete

AAGE01341824 89% to 494098990


 723 QAAYDKYSGVK (2) 755






1716 ALGGK 1730





 518 HIEFKPRPKG* 486


>AAGE01341824 89% to 494098990





 518 HIEFKPRPKG* 486



CYP3 clan

Four CYP9M related sequences and one new CYP9 subfamily, plus one pseudogene


>AAGE01023613 494247077  812172036 586045833 57% to 9M1 complete












>AAGE01008959 54% TO 9M1 74% TO 494247077 complete












>AAGE01012700 71% to 494247077 55% to 9M1 complete











>494569869 25% to 9M1 N-term 39% to 494247077 pseudogene of 494247077








>AAGE01026951 AAGE01099852 476324290 55% to 9M1

579013166 826063288 832528009 494192568 637071386

613990760 complete













>AAGE01015749 494133555 519945594  763120971 810094850 53% to 9M1 complete












>AAGE01236202 AAGE01528761 AAGE01574909 575351627 754305099 587660657 263512612

581727980 743856203 625109625 223413916

773058412 (exon 1) mate pair = 775439855 (exon 2)

832539269 578892595 complete 51% to 9M1












>AAGE01014192 813491936 639416242 762398872 complete

TC52960 TC20003 TC26029 TC39058 TC4763 TC7436

40% to CYP9J4 40% to 9A4 (new subfamily in CYP9)

AAGE02005788.1 4968-6548 no introns

ESTs DV359961,DV294300,DV294302,DV359959












CYP4 clan sequences


>AY433052 AAGE01072700.1 AY431937 88% to 4G16 complete

AAGE01141041.1 AAGE01223479.1 AAGE01094290.1













>AAGE01114834 52% to AY433052 same as TC67187 76% to 4G17N-term probable ortholog complete 80% to 4G17 full length

AAGE01340100.1 same as AAGE01229939.1 85% to 4G17 C-term, probable ortholog

633767131 823361413 823353110













>CYP4C38? exon 1 AAGE01133681.1 587572087 complete

These two pieces probably are from one gene, since there are no

Other closely related sequences found. 66% to 4C36



>CYP4C38 N-term AAGE01207392.1 AAGE01470307.1 71% to 4C27

824335234 761357490 744250376 592527729

570727647 754993699 585845687 593920597 613947338

594452687 575404595 749489367 579218945 825227784

AAGE01009885.1 TC66432 Length = 995 71% to 4C27 anopheles

AAGE01207392.1 matches the N-term part of TC66432

parts are on AAGE02022591.1 AAGE02022592.1. AAGE02022593.1

use these seqs













>Exon 1 of 4C25 ortholog AAGE01102043.1    80% to 4C25 complete

Exon 2 of 4C25 ortholog AAGE01326257.1

AAGE01078331.1 83% to 4C25












2788  E*  2793


>AAGE01094388.1 exon 2 4C like possible pseudogene fragment cannot extend




>AAGE01029369.1 72% to 4C26 62% to 4C25  complete

did blast with exon 1 of 4C26 to find best match

did blast with last 500bp of AAGE01029369 to find trace seq on (+)


mate pair = 759644271 will be downstream of AAGE01029369 and should match next

contig, possibly with N-term exon.  Contig match = AAGE01001656.1 (-)

over 15kb, but no P450 seq.  Might be a short contig between these

AAGE01030574.1 exon 2 4C like

586027613 matches first 500 bp on (-)

mate pair = 586024059  matches AAGE01059591.1 (+) no P450 seq

repeat with first 500bp of AAGE01059591

600013440 matches on (-) mate pair = 600014884

this matches two contigs AAGE01312028.1 (-)

and AAGE01029369.1 (+)  this one has a P450 seq

that is 4C like and complements this exon 2 seq.

Join them

Now use last 500bp of AAGE01030574 to find a trace file that matches on (+)

636183786 mate pair = 637148886 matches AAGE01001355.1

this is the same contig found in a search above going downstream from the N-term of a 4C like P450.  The intron must be more than 17kb

join exon 1 seq

AAGE01098344.1 best hit to 4C26 N-term

searched by megablast to get 585803103(+), mate pair = 585951518

searched WGS with this to find adjacent contig downstream

this = AAGE01001355.1 16kb, no P450 seq













1.295_1 AAGE01029369 Hils Version  15 diffs to blast file

AAGE02013631.1  exon 1, AAGE02013630.1 exon 1 exact duplicate,

AAGE02013629.1 exon 2, AAGE02013628.1  exons 3-5 use this seq









>476414268 92% to Aedes albopictus AY971511 complete

760814858 568935720 581452704 754413849 580048410

walked upstream to 531423840

walked to 529070673

walked to 824339230 mate pair = 823396717 matches C-term

AAGE01143020.1 63% to 4C28 AAGE01462557.1 62% to 4C37

AAGE01324666.1 exon 2 4C like same as 476414268

supercontig 1.295 frame = -













AAGE02013627.1 exon 1, AAGE02013626.1 exons 2-3 use this seq (3 diffs)












>AAGE01044016.1 AAGE01004063 47% to 4AR1, 614744667 579602080 complete

probably same gene as 4T1.6 (3 diffs), 4I1.3 (2 diffs)













>AAGE01046474.1 possible 4K2 like N-term joins with AAGE01021812





AAGE01021812 52% to AAGE01044016 54% to CYP4K2

supercontig 1.283 1387420 KILNTQSYASKSEDYDKVAEWIGYGL 1387497





3857 DDIREEVDTFTFA 3819 (0)






AAGE02013268.1 use this seq












>CYP4D23 AAGE01000026.1 476394815 TC65595 TC24018 TC42055 74% to 4D22

only 51% to 4D17, probable ortholog of 4D22 complete

4T2.8 (v1 2 diffs), 4T1.3 (v2 1 diff), 4T1.1 (v3 1 diff)

AAGE01263405.1 probable exon 1 of 4D22 ortholog




6248 LCALDVIC 6271 (1)








>CYP4D24 AAGE01006231.1 4T2.6 (100%) complete 494125342 62% to 4D16

AAGE01082298 bridged by 825775921 to AAGE01006231.1













>AAGE01055570 54% to 4D16 TC58022 AAGE01032454.1 512569922 complete

mate pair = 514720868 = C-term

walked upstream to 822913819 mate pair = 822913819 = C-term

walked up to 803280909 mate pair 808283299 matches mid region

walked to 519825648 mate pair 520507511 matches C-term

walked to 826165713 and 825253376 mate pair = 825244224 matches exons 2,3

walked to 528823040 and 572484877 mate pair = 572478448 matches exons 3,4

walked to 585907890 walked to 812022667 and 749632380 mate pair = 749635932

matches exon 2, walked to 578582171 (possible repeat region)

walked to 580094767 mate pair = 585907890 above so got past the repeat

also found 759050174 mate pair = 759046608.  This mate pair has an N-term seq

which is almost identical to AAGE01124480

another hit that matches 759046608 exactly = 824317331 so the seq is confirmed













>516274867 broken CYP4D exon 1 probable pseudogene




>AAGE01019344.1 AGE01032320 54% to 4D17 complete

AAGE01178606.1 exon 2 of 4D like seq, 45% to 4D17 but only 35% to 4D15

TC64783 Length = 903 83% to AAGE01055570

793219534 630759272 note that in 630759272 exons 2 and 3 are on the – strand

and exon 4 is on the plus strand. But the order is correct on 587120742

520001141 512663558,

AAGE01124480.1 516274910 = exon 1 most like 4D17

744614807 568757642 576385708 are exact matches so this seq is

really different from the seq of AAGE01055570

this is probably the N-term exon of seq AAGE01019344












>AY431801 64% to 4D24 AAGE01115931.1 AAGE01014858.1 AAGE01023514.1 complete

AY433130 change 1 aa use AAGE02013268.1























188583  LRPTYGVLLRLKKRQ*  188536


>CYP4H28 4T2.2 (2 diffs) complete

AAGE01082714.1 AAGE01027375.1 AY432644 55% to 4H18











>4H29 4I1.8  512549996 AAGE01010708.1 784728638 complete








AAGE02013311.1 use this seq (3 aa diffs)











>476148479 476152924 832469399 620727729 529569782 68% to 4H18 complete










>AAGE01049176.1 67% to 4H14 complete












>494155296  56% to AY205085 66% to 4H14 793189512 AAGE01213118.1

AAGE01473588.1 AAGE01538714.1 531423523 512616786 570666861 571502407

supercontig 1.85 Frame = - complete













AAGE02005220.1 Length=120659 USE THIS SEQ












>TC65985 TC16577 TC24796 TC37697 57% to CYP4H14

AAGE01321728.1 AY205085 AAGE01106416.1 complete











AAGE02013268.1 use this seq (3aa diffs) no introns











>AY431450 65% to 4J10 AAGE01108571 514842991 complete

continues on AAGE01227281.1 AAGE01378346.1













>AAGE02025842.1 first P450 on contig (of two)

6 aa diffs to AY431450 all in short interval

trace files 811916166, 586617316, 582273387 match this seq

580134265, 753220309, match AY431450

There may be two sequences

Searched with the first 211 nucleotides to see if there were two

Alternate matches affecting synonomous codons. All but one trace file matched

This genomic seq.










182113  KVQFAKRKANATRS*  182157


>AAGE01397643.1 84% TO 223407477 569795084

250bp downstream of AAGE01227281.1

join with AAGE01226366.1





>AAGE01226366.1 95% to AAGE01331087.1 10 aa diffs (allele?)







AAGE02025842.1 ESTs DW194177.1 EB096538.1 use this seq

Second P450 on contig (of two)




182979  MSKFTLNTIC (1)







184047  LRSTNPIEVRFERR  184088


>AAGE01331087.1 61% to 4J5 575366287 574128015

no ESTs for this seq. no exact match in WGS 95% to AAGE02025842.1 second gene







>AAGE01288441.1 97% to AAGE01216085.1 10 aa diffs

note on finding the C-term.  This seq is 74% identical to 4J5

at the C-term.  This 4J5 seq continues as


Which is 59% to AAGE01331087 so this is a good model

The N-term part of this seq has only one seq in the trace files

So it may be a poor version of the AAGE01216085.1 seq.









>AAGE01216085.1 61% to 4J9 578920794 complete

TC57837 Length = 832 100% to AAGE01216085 extends the end

519943525 826152951 513457906 new C-term for 4J seq

attempted walking to join with N-term part. Ran into a gap

613942247 589588262












>223407477 AABIG09TP.gz 223407646 AABIH08TP.gz 65% to 4J9

AAGE01099570.1 574077942






Correct seq 88% to AAGE02025842.1 matches Nelson 223407477 on top












>AAGE02030510.1 Length=13206 98% to AAGE02025843.1 6807-5100. 9 aa diffs

new seq




10616  LQPVMSKFTLNTIC (1) 10575








These two seqs are very close but the region QDRIYSEILQVYSNKLQSALAFTPQDY

Has 4 aa diffs.  Trace files support both sequences

588906795, 590281011 match this seq.

832533501, 832391117, 589181510, 579871626, 592076987  match the other seq AAGE02025843.1


>AAGE02030510.1 pseudogene like AY431450 new seq







>AAGE01099570.1 4J like pseudogene







>AAGE01003123.1 C-term of 4J like seq 90% to AAGE01331087, pseudogene




>476375054 Pseudogene 61% to 4J5, 4aa diffs to AAGE01003123, stop codon in same place




>AAGE01584611.1 89% to AAGE01005255.1 matches 574201551, 520163843

note mate pair of 520163843 = 520524408 that has a C-term

like AAGE01005255, but not identical.  These two genes are linked

AAGE01584611 is upstream of 520524408 on the same strand







>520524408 593182570 813103660 574115512 593092990 825253407

579726574 exact match to AAGE01484914.1

96% to AAGE01005255, but not the same gene

This seq is identical to TC57838

TC57838 Length = 974 9 aa diffs to AGE01005255 complete

593092990 and 593182570, 825253407 579726574

Another set of WGS seqs are an exact match to AGE01005255

So there are two very similar gene sequences that are 95% identical.












AAGE02035951.1 missing the last exon use this seq 3 aa diffs to 520524408




2099  LNTIC (1) 2085








>TC57838 TC48249 matches 593092990 and 593182570, 825253407 579726574

 cyan = corrections















>AAGE01005255.1 55% TO 4J9 TC57836 complete











>AAGE01001298.1 AAGE01138953 gene a C-term complete

821735340 matches on the (-)

therefore, the mate pair 821748090  is upstream an unkown amount

blast WGS with the mate pair to reach a contig upstream.

it matches AAGE01001298 from 587 to 1544, not useful

use the first part of AAGE01001298 to find a trace file that matches on the (-)

get the mate pair (upstream) and blast WGS. 529508154 matches on (-)

the mate pair is 529508153.  This matches AAGE01043608.1 on the (-)

from 1130-67 Therefore AAGE01043608.1 points away from AAGE01001298.1.  The N-term seq on AAGE01043608.1 seems to be the

upper part of the C-term seq on AAGE01001298.1

did a mate pair search with first 3000bp of AAGE01001298.1, no success

AAGE01043608 46% to 325C1 N-term











AAGE02000570.1 EST DV312052.1 F = Y in 3 ESTs use this seq

DV352514.1, DV365167.1 42% to 325C3 Anoph.












AAGE02000570.1 = AAGE01056055.1 N-term 61% to 325E1 57% to AAGE01193335.1






note next P450 is at 86kb but there is no P450 seq between 69945 and 86000

This is a pseudogene fragment


>AAGE01001298.1 gene b N-term this seq joins with AAGE01024167a complete

AAGE01024167a parts of 2 genes 3-365 = C-term, 2021-2299 = N-term

743263008, 634987900 631579630 591886482

591886482 (+) = mate pair of 591882912 (-) that matches the lower part of AAGE01024167 on the (-) strand, so the mate pair will be on the plus strand

upstream of part b so it must belong to gene a

528593770 (+) = mate pair of 521934839(-)

528593770 matches AAGE01001298.1 gene b exon 3










AAGE02000570.1 second of five P450 N-terms on this contig = AAGE01024167a











>AAGE01024167b parts of 2 genes 3-365 = C-term,

1937-2299(+) = N-term complete

use bottom to find (+) strand matches

this region seems to be in a repeat but

611427889(+) is 100% match mate = 611438962

no good match in WGS

move back upstream on AAGE01024167 to avoid the repeat

575338571(+) is outside the repeat, mate = 575344991 insert = 4000bp

matches AAGE01121136.1 (+) 2309bp

use the top of AAGE01121136 to find (-) strand matches

743252107(-) mate = 743258565 insert size = 4000bp

matches AAGE01224146.1 (+) 1587 bp

this seq has a P450 on it (join)

AAGE01224146 42% to 325C3 TC64516 no ESTs at TIGR for upstream part

578075956, tried mate pair search for this seq

68% to AAGE01075759













AAGE02000570.1  first of five P450 N-terms on this contig

Same as AAGE01024167b



continues on AAGE02000569










>AAGE01004336.1 N-term 36% to 325E1, tried mate pair search with first

1000bp of AAGE01004336, no success

625112877 (+), 586057308

636086813 matches the first 500bp on the (-)

the mate pair (upstream) = 634991647.  Search WGS with the mate

pair seq to identify the upstream contig = AAGE01044598.1 (+) 2141-3111

this seq does not have any P450 fragments on it, keep going.

Use the first 500bp of AAGE01044598.1 to repeat procedure

595142314 matches on the (-) mate pair = 594349756

this matches AAGE01298676.1 on the (+) from 439-1278

These pieces complete a P450

AAGE01147701 AAGE01298676 494130880 72% to 494257581 38% to 325C3 56% to AAGE01041126












>494576331 90% to 494087031 43% to CYP325C1 not in WGS section except N-term

744442433 821640843 (N-term part may not belong to this gene


        847 QLLDESALGRSFSNTEIVQNVYTMLAA 767) 494576331

end of 6331 has no matches in trace archive or WGS

whole 821640843 has no matches in trace archive or WGS

cannot extend seq upstream.

note 21-120 of 494576331 matches 100-1 (-) of AAGE01456445.1 100%

AAGE01456445 1-48 = extreme C-term of this P450

Use top of AAGE01456445 to find (-) matches

575128039(-) mate = 574349186

matches AAGE01279448.1 (+) 1397bp upstream of P450 seq below

613966178(-) mate = no mate

use top of AAGE01279448 for (-) strand matches

827530978(-) mate = 826071276 matches a repeat

757071970(-) mate = 757078385 matches a repeat

used the bottom of AAGE01279448 for (-) strand matches

no (-) strand matches

tried walking upstream of AAGE01279448

803206452(+) goes 690bp upstream, use to find next contig

AAGE01098162.1 (+) 2623bp is the best match, but only 92%

There may not be a WGS match

Continue walk from first 600 bp of 803206452

521895948(-)  extends seq 588-1173

invert and blast against WGS for next contig

matches AAGE01511887.1(+) 945 bp and AAGE01256996.1 (+) 1466bp

note these were also found in the 494087031 region

must be an error in one of these gene assemblies

the match seen in AAGE01456445 1-48 to the C-term is identical to 494576331

and not to the 494087031 gene.

Use bottom of 6331 for (+) strand matches, try to link to 9448

Use bottom of 6445 for (+) strand matches, try to link to 9934

578396833 (+) mate = 578471877

755814757(+) mate = 755821174

821647414(-) mate = 821640843 with N-term part of 6331 P450

this seq extends 6445 seq.

759288116 extends 821647414 (+) farther into the gap mate = 759284526

AAGE01642682 continues from 8116 overlap 0nly95% match maybe not

568531526 extends AAGE01642682(+) mate = 568527984

757700898(-) overlaps 759288116 mate = 757698399 (no WGS match)

823382968 (-) matches 757698399











>494087031 86% to 494576331 46% to CYP325K1

AAGE01227180.1 same as AAGE01139230.1 (overlap)

Use the last 500bp of AAGE01227180 to find a trace seq on (+)

Wrong way so AAGE01256996 may be downstream of 7031

And upstream of 6331

519661758 matches (+) mate pair = 519808856

this matches AAGE01256996.1 only 1466bp and no p450

574210685 matches (+) mate pair = 574203231

this matches AAGE01139934.1 (-) no P450

591889338 matches (+) mate pair = 591895771

matches AAGE01139934.1 (-) again only 2117 bp

use last 500 bp of AAGE01139934 to repeat

822879728 (+)  mate pair = 822884411

matches AAGE01511887.1 (+)  945bp and AAGE01256996.1 (+)

note AAGE01256996.1 must be downstream of AAGE01139934

760895106(+) mate pair = 760897640

best match = AAGE01465489.1 1006bp seems to be in a repeat

try beginning of AAGE01256996 look for (-) stand match

to go farther downstream with the mate pair

823320338 (-) mate pair = 823337193

matches AAGE01007603.1 (+) 10kb no P450, looks like a repeat


may be a problem with this assembly so used 812167174

a 494087031 specific sequence to find (-) strand matches

with upstream mate pairs

586126037(-) mate = 586046641

matches AAGE01139934.1(-) 2117bp differs from AAGE01279448.1

633003388(-) mate = 632990527

matches AAGE01139934

use bottom of AAGE01139934 for (+) strand matches

574203231 (-) 100% mate = 574210685 error used – match here

matches AAGE01227180.1 (+) 1575bp

also matches AAGE01139230.1 (-) 2124 bp (more upstream)

still in coding region

584214911 (+) 1 nuc diff mate = 584218501 same match as above

should use 825270301(+) mate = 825997756

matches AAGE01511887.1 (+) 945bp

(-) match to AAGE01511887 = 588751488 mate = 588755052

about 4000bp insert size

matches AAGE01217117.1 (-) 1618bp

803206452(+) extends 825997756 about450bp

The mate pair of 803206452 = 808267411

This seq matches AAGE01139934

803206452 matches AAGE01279448.1 on (+)

574349186 extends AAGE01279448 on (+) about 200bp

mate = 575128039 matches AAGE01456445(-) 100%

822879728(+) extends AAGE01139934 on (+) 750bp

835013678(+) extends 822879728 about 150bp

569815318(+) may extend 835013678 about 800bp

use top of AAGE01227180 to find (-) strand matches

571497371(-) mate = 571493799

matches AAGE01248465.1(+) 1495bp

812167174(-) mate = 813478515

matches AAGE01115835.1 (-) 2373bp

760773555(-) mate = 760780002

matches AAGE01115835 and AAGE01248465

625133249(-) extends AAGE01115835 about 500bp upstream

toward AAGE01227180, took this seq inverted it and blasted WGS

matched AAGE01139230

620662629(-) extends AAGE01139934 upstream 400bp

592204606 goes upstream 180bp

529229530 may continue 592204606 and AAGE01139934 upstream

still no match in WGS

819718554 extends farther in same direction

matches AAGE01227180.1










AAGE02000572.1 exon 1 use this seq

AAGE02000573.1 exons 2 to end












494087031 gene C-term matches 100% to 571497371 607-713

754300186 169-275, 812167174 945-1000 (partial 1-56)





The other seq is 613966178(-) 848-745, 494576331 (-) 173-70

744442433 605-708, 575128039 (-) 757-674 with a few errors



Tgctggaactttcatcggaatgtttagttcgatttaacaaacgatga AAGE01456445


AAGE01456445 is identical to the 494576331 seq SS not ST


Note 494579893 is the mate pair of 494576331

744448874 is mate pair of 744442433

574349186 is mate pair of 575128039


>AAGE01205264.1 N-term 41% to 325C2 63% to AAGE01102953

use top of this seq to find (-) matches

575508824(-) mate = 575515286 matches a repeat region

618132741(-) mate = 620849900

matches AAGE01592485.1 (+) 822bp 100% no P450

also matches AAGE01067688.1 (+) 3264bp 1 nuc diff, no P450

Note: this seq connects via numerous steps to AAGE01001451

Join complete

579979942(-) mate = 579983471

matches AAGE01293853.1(+) 1356 bp no P450

595039631(-) mate = 595043179 matches AAGE01293853

636182639(+) goes upstream 283bp

521922341(+) extends back about 530bp

matches AAGE01570704.1 (+) 859 bp

also matches AAGE01423387.1 (-) 1072bp

AAGE01001451 47% to AAGE01025218 41% to 325C3

used 14000-14600 region to find (+) strand matches

578828140(+) mate = 578830669

matches AAGE01294062.1 (-) 1356bp

also matches AAGE01359563.1 (-) 1199bp

581388714(+) mate = 581381243 matches AAGE01294062

use the end of AAGE01294062 to find (+) strand matches

580182961(+) mate = 580167672

matches AAGE01104198.1 (+) 2529bp

591439015(+) mate = 589183870

matches AAGE01139429.1 (+) 2122bp

and AAGE01295550

use the top of AAGE01295550 to find (-) matches

813088108(-) mate = 813097585 matches AAGE01104198(-)

630167999(-) mate = 630791391 matches AAGE01084800(+)

use the top of AAGE01084800 to find (-) matches

750327728(-) mate = 750321309 matches AAGE01067688(-)

note: two intron boundaries revised May 17, 2006, now corrected























































Query  503    MSDILKHPELVPKEGRE  519


Sbjct  40949  MSDILKHPELVPKEGRE  40999


>AAGE01005370.1 N-term 67% to AAGE01071933 complete

AAGE01041126 C-term 39% to 325C1 78% to AAGE01070673

used bottom for (+) strand matches

753010618 (+) mate = 753014216

matches AAGE01028971.1 (-) 5369 bp no P450

832392017(+) mate = 827574490 matches AAGE01028971

633009586(+) mate = 632994720 matches AAGE01005370 about 95%

632994720 has no exact matches in trace archive so it

may be a poor quality seq.  Best matches all match AAGE01005370

This is evidence to link these N and C-terminals, but it

Is not strong.  There seem to be several repeats in the

Intervening seq that make it very hard to span this region.

Join with AAGE01005370





     FLKAVG 2677








>AAGE01071933.1 N-term complete

636174215 (-) mate = 637138541

matches AAGE01109197.1 (+) 2460 bp

use first 500bp of AAGE01109197 to find (-) match

572574319 (-) mate = 572566832

matches AAGE01603317.1 (+) 803bp no P450

821756106 (-) mate = 822887151

matches AAGE01368176.1 (+) 1180bp no P450

AAGE01070673 76% to AAGE01041126 825771011

used the end of AAGE01070673 to find a (+) strand match

used mate pair to jump to an upstream contig

822916395 (+) mate = 821723190, matches AAGE01370794.1 (+) 1174bp no P450

581417565 (+) mate = 581414014, matches AAGE01622151.1 (+) 764bp no P450

use all of AAGE01622151.1 to find (-) matches

520523028(-) mate = 520159312

matches AAGE01071933.1 (-) 3153bp = N-term of P450 join

494257581 44% to TC59131 48% to 325K

same seq as AAGE01070673

AAGE01004336.1 very end (11kb region) matches 494257581

There is a full p450 in the 1-4000 region of this contig

These genes are linked.  This seq is just beyond the end of

AAGE01004336 on the (-)












>AAGE01120855.1 N-term 36% to 325C2, 52% to AAGE01039338 complete

520695497 (+) mate = 521887392

matches AAGE01164267.1 (-) 1919 bp no P450

595144689 (+) mate = 594350190

matches AAGE01088447.1 (-) 2793 bp no P450

592694963 (+) mate = 592508489

matches AAGE01426313.1 (+) 1067 bp no P450

494193586 52% to 494159924 50% to 325C, 52% to AAGE01039338

AAGE01018213.1(+) AAGE01548387.1

Use top of AAGE01018213 for (-) strand matches

586006569(-) mate = 589171602

matches AAGE01164267.1 (+) 1919bp

this contig also found in AAGE01120855 search join sequences

seq revised May 17, 2006












AAGE02009773.1 Length=286003









Phase 0 boundary at KSMF/ASV not possiblem phase one at FAAK/TSV is possible

ttcgccgcgaaaagtatgttt gttctgtgaa

F  A  A  K  S  M  F

atta tagcaagtgt

I  I  A  S  V





Query  179     ELVCATTLGFDINQFDDPDGFAHNME-------------------------RVFYVASRR  213

               ELVCATTLGFDINQFDDPDGFAHNME                         RVFYVASRR




N  M  E  R  * must use phase 2 GT


I  L  F  R  V  F  Y

My seq has an extra R (remove it)





Phase 0 possible as above

There is no GT after YREE so my seq is not possible use this seq

223261 tctgcagttg gatacagttt atcgatggac taaggattac cgcgaggaac gagcccttcg

223321 cgagaagatg gagagttatg caatgaaggt agtgaatggt ataatgcagg gctggttgca














Query  426     HRYAFLPFSGGRRDCLG  442


Sbjct  224578  HRYAFLPFSGGRRDCLG  224628






>AAGE01124926.1 N-term 41% to 325E1 complete

found mate pair 739505219 of 739501659 that matches the end of

AAGE01124926.  This seq matches = AAGE01015918

AAGE01015918 67% to AAGE01147701 joined by mate pair

Also on AAGE02018310.1











>AAGE01025218.1 44% to 325C3 500-2700 region complete












>AAGE01239763 95% to AAGE01025218 825989618 757493333 813564487 complete












>AAGE01027431.1 AAGE01206292 (5 aa diffs)  45% to 325J1 complete

476419948 46% to 494292861 (probable hybrid gene seq)




4090  LDMVY (1)  4104








AAGE02021468.1 13 diffs all in first 167 aa










5643  HMITLSDRRK*  5611


note: 578965186 is a 100% match to AAGE01027431 above in the first exon

There must be two sequences

Trace file 581849161 also matches this region 100% for 189 bp

Including 4 amino acid differences

512981174 also matches including 6 differences from YIIINH

>gnl|ti|578965186 name:1095030068504 mate:578923620 green = exon 1


















The second exon in two of these trace files has a 2 aa insertion and two

Other differences shown below

This seq continues in 520523626



















A complete second sequence is shown here

This appears to be a real gene 95% identical to AAGE02021468.1

Constructed from trace files 578965186, 581849161, 512981174, 520523626












>AAGE01054827 AAGE01084906 AAGE01489548 41% to AAGE01025218 complete

44% to AAGE01064173

used first 500bp of AAGE01054827 for (-) trace files

644304896 (-) mate = 639417477 no exact match

579477042 (-) mate = 579483479

matches AAGE01212501.1 (-) 1639 bp no P450

>AAGE01097831.1 exon from phase 2 to ILQ boundary 54% to AAGE01224146

may join with AAGE01054827

searched trace files with first 250bp to correct I-helix region and extend

813896966 joins with AAGE01075759

AAGE01075759 67% to AAGE01224146 813896966, 68% to AAGE01224146

used (+) matches to continue with mate pairs for upstream seq

593176095(+) mate = 593182547 matches a repeat

758931963 (+) mate = 758929444 matches a repeat

used AAGE01075759 2101-2640 to avoid the repeat looked for (+) matches

575421893(+) 100% match, but still in repeat, mate = 575475472

matches AAGE01212501.1 (+) 1639 bp no P450

note same contig found in search from AAGE01054827











2697 FNAALVLAGKH* 2677


>AAGE01132222 40% to AAGE01050332 N-term 42% to AAGE01064173 complete

AAGE01009694 494159924 51% to TC59131 47% to 325K1, 52% to AAGE01239763

use top 500bp to find trace file seqs with (-) strand matches

578469145 (-) mate = 578753270

matches AAGE01043606.1 (+) 4116bp no P450

use top 500bp to find trace file seqs with (-) strand matches

587753164 (-) mate = 587749602

matches AAGE01438960.1 (-) 1045bp no P450

636100588(-) mate = 636100414

matches AAGE01132222.1 (-) 2190 bp join with P450 N-term












>AAGE01077592.1 N-term 37% to 325H1 same as AAGE01398514.1

use bottom 1000bp to search for (+) strand matches for mate pairs

529517080 (+) mate = 529517079

matches AAGE01008879.1 (-) 9326 bp no P450

use bottom 1000bp of AAGE01008879 to continue

look for (+) strand matches

578668939 (+) mate = 578777890

matches AAGE01190920.1 (-) 1749bp no P450

819718395 (+) mate = 820309477

matches AAGE01181611.1 (+) 1804 bp no P450

also matches AAGE01190920.1 (-)

620666104 (+) mate = 618185026

matches AAGE01179350.1 (+) 1818bp

use bottom of AAGE01190920 look for (+) strand

521973383 (+) mate = 520697038 matches a repeat

755995765 (+) mate = 755992211

matches AAGE01400949.1 (-) 1113 bp

757659867(+) mate = 757662389

matches AAGE01400949.1 (-)

use top of AAGE01179350 to find (-) strand matches

568764550 (-) mate = 578941007

matches AAGE01023525.1 (-) 6010bp no P450

use bottom of AAGE01023525 to find (+) strand matches

579862900(+) mate = 579996877 no good match only 95%

630748606(+) mate = 627442145

matches AAGE01032128.1(+) 5053bp

also matches AAGE01213139.1 (+) 1636bp

use top of AAGE01213139 to find (-) matches

757669846(-) mate = 754351538

matches AAGE01083633 (-) 2889 bp no P450

579851495(-) mate = no mate







AAGE02000578.1 complete


trace files that match this seq 835981972, 585800596, 578620585 (last exon)

Note 20kb intron












Note trace 618127454 matches AAGE01531287 100% including the five differences

Above. Nucleotide seq is 96% differing at 21 positions from AAGE02000578 (last exon)

476383722, 575812863 also match this seq.

There are two seqs (possible alleles?)

I could not find differences in the first two exons


>AAGE01056055.1 N-term 61% to 325E1 57% to AAGE01193335.1

use first 500 bp to find a (-) strand match in megablast, get the mate pair

to move toward exon 2

578797200 (-) mate = 578664560

matches AAGE01174552.1 (+) 1848bp

575416824 (-) mate = 575383266

matches AAGE01180945.1 (+) 1808bp no P450

575353233 (-) mate = 575356809

matches AAGE01180945.1 (+)

use first 500bp of AAGE01180945.1 to find (-) strand match

581543226 (-) mate = 581549670

matches AAGE01277447.1 (+) 1402bp no P450

586630848 (-) mate = 586627267 matches AAGE01277447.1 (+)

use first 500 bp of AAGE01277447 to find (-) match

648073848 (-) mate = 648073771

matches AAGE01397305.1 (+) 1120bp

584129384 (-) mate = 584132944

matches AAGE01193335.1 (-) 1736bp (another P450 N-term)

also matches AAGE01089335.1 (+) 2777bp

end of this P450 may be in one of the three gaps between contigs

check gap between 7447 and 0945

759108191(+) matches top of AAGE01180945 and goes upstream 422bp

this region is in a repeat

754353423(-) goes about 675bp upstream

matches AAGE01128818.1 (-) 2226bp bp no P450 but

this same contig was found in AAGE01531287 search

also mate pair of 754353423 = 754349249 matches AAGE01193335(-)

and AAGE01089335.1(+)

631542973 matches the end of AAGE01277447 and goes downstream about 580bp

This region matches (no good WGS match)

join AAGE01531287 and AAGE01056055

AAGE01531287.1 46% to 325F2  476383722 38% to TC65595 43% to AAGE01347884

AAGE01381118.1 3 aa diffs 618127454 578620585

Next contig = AAGE01128818.1 no P450

Use the top of AAGE01128818 to find (-) strand trace file matches to continue.

No (-) strand matches found.  Used 835983442 to move upstream about 500 bp, used this seq to look for next upstream contig

This was in a repeat region

576268671 goes upstream 576bp 580164240 extend about 500bp more

521859673 goes 682 bp more

took most upstream seq and blasted WGS for next contig

this matches AAGE01128818(-)

use the last 500bp to search for (+) matches

(used the wrong end before)

586093264 (+) mate = 586089708 contains a 23bp repeat AATTTTCCTGGAATTTTGAACAG

matches AAGE01029644.1 (+) 5300bp no P450

take the end and look for (+) matches

587583422(+) mate = 587579857

matches AAGE01527387.1 (+) 924bp no P450

586096527(+) mate = 586100102

matches AAGE01523698.1 (-) 929bp

also AAGE01079226.1 (-) 2981bp no P450

Note this gene is still missing WXXXR to ETAM, ETAM to phase2, phase 2  to ILQ

These pieces may be between AAGE01531287 and AAGE01128818

Or AAGE01180945 and AAGE01056055

Use bottom of AAGE01531287 to extend into gap

Matches 586206960 goes downstream about 500bp matches AAGE01128818

Missing exons not here so must be between AAGE01180945 and AAGE01056055

Used bottom of AAGE01180945 to extend into gap

588808258 (+)100% match extends about 400bp

matches AAGE01464688.1(-) 1007bp no P450

used top of AAGE01464688 to go up, 749551959(-) this

matches AAGE01174552.1 (+) seen above no P450 look

between AAGE01174552 end and AAGE01056055 beginning

759111770(-) extends AAGE01174552 end 419bp

matches AAGE01174704 96% not best match no P450

824260043(-) extends AAGE01056055 upstream 650 bp no good WGS match

these missing exons may be in a seq. gap



missing WXXXR to ILQ







>AAGE01102953.1 N-term 41% to 325C2 63% to AAGE01205264

use the top to look for (-) strand matches

578991895(-) mate = 578989377 4000bp away

matches AAGE01203025.1 (+) 1685 bp

744451246 (-) mate = 744448722 4000bp away matches AAGE01203025

579985225(-) mate = 579831226 matches AAGE01203025

use the top of AAGE01203025 to find (-) strand matches

521843675(-) mate = 521843676 8500bp away

matches AAGE01134554.1(-) 2167 bp no P450

755155471(-) mate = 755151937 matches AAGE01134554

519673863 (-) mate = 519832722 no ideal matches

use bottom of AAGE01134554 to find (+) strand matches

759361419(+) mate = 759364946 4000bp away

matches AAGE01333805.1 (-) 1256bp

574325046(+) mate = 574328615 matches AAGE01333805

574309681(+) mate = 574306139 matches AAGE01333805

use bottom of AAGE01333805 to find (+) strand matches

574303286(+) mate = 574310750 4000bp away

matches AAGE01574296.1 (-) 853bp

818802134(+) mate = 818798999 3500bp away

matches AAGE01606128.1 (-) 798bp

521922340(+) mate = 521922341 8500bp away

matches AAGE01570704.1 (+) 859bp

also matches AAGE01423387.1 (-) 1072bp

also matches AAGE01205264.1 (+) 1674bp this seq has a P450

The P450 is only another N-term and not a complementary seq.

The end of AAGE01102953 must lie between these two N-terms

Go back from AAGE01205264 to try to find it

Use end of AAGE01205264 to find (+) matches

644326835(+) 100%, but in a repeat region mate = 644291825

matches AAGE01173044.1 (+) 1858 bp

use bottom of AAGE01173044 to find (+) matches

520174168 (+) mate = 520529036

matches AAGE01161151.1 (-) 1942bp no P450

759234929(+) mate = 756228559 in a repeat

note 574149612 is the mate pair of 574146059

a 98% match to AAGE01102953 (902-1440bp (+) strand).

574149612 blast matches AAGE01026029(-)

this means AAGE01026029 is upstream of AAGE01102953

in the same orientation.  These mate pairs are 40,000bp apart

Since the C-term is in front of the N-term they must be from two

different genes.




>AAGE01011475.1 N-term 39% to 325C2 57% TO AAGE01205264

576763861 (-) mate = 576734824

matches AAGE01470952.1 (+) 998 bp

AAGE01470952 matches traces 584345722(+)

576734824(+) 759713549(-) 513462158(-) 644338159(-)

832391075 extends 576734824 toward AAGE01011475

588911372 extends 832391075 toward AAGE01011475

588911372 matches AAGE01277343.1(+) 1403bp

819687897 extends AAGE01277343 by 600bp

753930249 extends 819687897 by 300bp

this matches AAGE01478066.1 (+)

569795945 adds 200bp

576763861 also matches AAGE01416311.1 (-) 1084bp

use the top of AAGE01470952 to find (-) matches

513462158(-) mate = 513455708

matches AAGE01108027.1 (+) 2475bp

644338159 (-) mate = 644341403

matches AAGE01000025.1 (-) 31853 bp in repeat

also matches AAGE01020018.1 (-) 6517bp in repeat

use top of AAGE01108027 to find (-) strand matches

821712794(-) mate = 822910015

matches AAGE01412652.1 (-) 1091bp

575363756(-) mate = 575417301

matches AAGE01201801.1(-) 1691bp

use bottom of AAGE01201801 to find (+) matches

587969133(+) mate = 587971667

matches AAGE01314237.1(+) 1304bp

also matches AAGE01199108.1 (-) 1705bp

755591529(+) mate = 755588994

matches AAGE01314237

use top of AAGE01314237 to find (-) strand matches

520544941(-) mate = 519998176

matches AAGE01380710.1 (-) 1154bp

also matches AAGE01070573.1(-) 3188bp

776272502(-) mate = 760988636 (no good match),776276064 matches AAGE01070573

use the bottom of AAGE01070573 to find (+) matches

581448944(+) mate = 581451482

matches AAGE01012162.1 (-) 8204bp no P450

use the bottom of AAGE01012162 to find (+) matches

815215884(+) mate = 815228284

matches AAGE01018936.1 (-) 6693bp no P450

630764106(+) mate = 627377245

matches AAGE01018936

use the bottom of AAGE01018936 to find (+) matches

827562568(+) mate = 826189694

matches AAGE01344368.1 (-) 1232 bp


note try extending from exon 1

638540618 adds 292bp downstream

638532364 continues to extend from 435-977

579935629 extends about 300 bp more then this matches

AAGE01020538.1 look for (-) matches to top of seq

528804330(-) extends 400bp mate = 521977783

matches AAGE01107049.1 (-) 2488bp

579020337(-) mate = 579026800

825733263 extends 528804330 seq about 400bp

mate = 825726173 matches AAGE01281689.1 (+) 1390bp

also matches AAGE01448499.1(-) 1030bp

try to extend AAGE01107049

581836134 (+) extends mate = 581839689 matches AAGE01164529

625165915(+) extends mate = 625084666 matches AAGE01164529

587867770(+) extends mate = 587871313

matches AAGE01164529.1(+) 1917bp

AAGE01026029 TC59131 TC50633 41% to CYP325C2 476413823, 64% to AAGE01111617

used bottom of AAGE01026029 to find (+) strand trace files for mate pairs

819714450 (+) mate = 819714180

matches AAGE01378352.1 (+)  1158bp no P450

571195913 (+) mate = 571382711 40,000bp away

matches AAGE01610084.1 (+) 790bp no P450

757966935(+) mate = 757964404

matches AAGE01076861.1 (-) 3034bp

use bottom of AAGE01076861 to find (+) strand trace files

600027741 (+) mate = 600565908

matches AAGE01218034.1 (-) 1614 bp no P450

use bottom of AAGE01218034 to find (+) strand trace files

522072791(+) mate = 528934371 matches AAGE01011475(-) (N-term P450)





missing exon 2









AAGE02009114.1 EST DV278487.1 use this seq










38003  YAVITG (0) 38020







>AAGE01046733 N-term 41% to 325C1 50% to AAGE01064173, 53% to AAGE01102953

used last 500bp to search for trace files (+) strand to get mate pairs

575129702(+) mate = 575133272 about 4000bp away

matches AAGE01078543.1 (+) 2996bp no P450

832524160 (+) mate = 832511205

matches AAGE01295016.1 (+) 1353bp no P450

AAGE01111617 44% to 325C2 62% to AAGE01026029

use bottom 500bp to find (+) strand matches

637074140(+) mate = 636170633 about 3500bp away

matches AAGE01198799.1 (-) 1707 bp no P450

587396559 (+) mate = 589186032 matches AAGE01198799.1

use the bottom 500 bp of AAGE01198799 to find (+) strand matches

813882368(+) mate = 813145290, 813876578 about 3500bp away

matches AAGE01078543.1 (-) search down from AAGE01046733 also

found this contig so these two sequences should be joined complete












AAGE02009113.1 Length=35743






Continues on AAGE02009114.1 Length=83514









>AAGE01025964.1 Length=5712 looks like pseudogene version of exon 3 from

AAGE01046733 gene with two frameshifts 44%






>AAGE01050332 N-term 43% to 325C3 68% to AAGE01064173 complete

probably joins AAGE01062475 since both parts are very similar to AAGE01064173

These seqs seem to be about 25kb apart

used first 2500bp to do a mate pair search

823383326(-) mate = 822882346

matches AAGE01146758.1 (+) 2057bp

519958430(-) mate = 520159488

matches AAGE01492644.1 (-) 970 bp

also matches AAGE01007236.1 (-) 10050bp no P450 in a repeat

[some (+) to 7236 = 588906424, 584180985, 578472808

570791474 (near end) mate = 570802630 8500bp away

528805831 mate = 520588493 8500bp away

520588493 matches AAGE01435940.1(+) also found

in search from C-term direction starting with AAGE01062475


644343133(-) mate = 644350619

matches AAGE01147442.1 (-) 2051 bp no P450

520003334(-) mate = 520199507

matches AAGE01147442

639101672(-) mate = 637789479

matches AAGE01146758

[matches to AAGE01146758 = 569633492(+)


753071933(-) mate = 753068371 matches AAGE01146758

572559845 (-) mate = 572556276 matches AAGE01147442

581849846(-) mate = 581712988 matches AAGE01146758

use top of AAGE01146758 to find (-) matches (in a repeat)

use bottom of AAGE01147442 to find (+) matches

633007683(+) mate = 633009196

matches AAGE01007236.1 (-) 10050bp no P450 in a repeat

579756463(+) mate = 579750017

matches AAGE01492644.1 (-) 970bp no P450

520514512(+) mate = 520119306

matches AAGE01293135.1 (-) 1358bp

818781498(+) mate = 813898164

matches AAGE01545749.1(-) 897bp

757662582(+) mate = 757660034

note did a mate pair search of whole sequence

570569222 is a 96% (-) match with mate pair 570572811

this mate pair matches AAGE01224146

note: the mate pairs are 40,000bp apart

570572946  is a 96% (-) match with mate pair 570596480

this mate pair matches AAGE01224146

note: the mate pairs are 40,000bp apart

AAGE01121756.1(-)  overlaps end of AAGE01147442 by 400bp







AAGE02000569.1 use this seq










49507  MIA (0) 49515








>AAGE01062475 3413bp 494267002 53% to 494159924 53% to 325C 67% to AAGE01196445

use top 500bp of AAGE01062475 to find (-) matches and get the mate pairs

570785063(-) mate = 569751422

matches AAGE01407923.1(+) 1100 bp

529462795(-) mate = 529069593

use the top of AAGE01407923 to find (-) matches

575474529 (-) mate = 574253700,575420959

matches AAGE01433232.1 (-) 1055bp no P450

also matches AAGE01445502.1 (+) 1035bp no P450

use the end of AAGE01433232 to find (+) matches

578624953(+) mate= 578709633

matches AAGE01073717.1 (+) 3109bp no P450

use top of AAGE01073717 to find (-) matches

832544134 (-) mate = 832533932

matches AAGE01531222.1 (-) 918bp

823397032 (-) mate = 824324730

matches AAGE01466172.1 (-) 1005bp

use bottom of AAGE01466172 to find (+) strand matches (in repeat)

use the end of AAGE01433232 to find (+) matches again

578657876(+) mate = 578708713

matches AAGE01111705.1 (+) 2426bp no P450

use the bottom of AAGE01111705 for (+) strand matches

578708713(+) mate = 578657876

matches AAGE01238879.1 (+) 1529bp no P450

622012470 (+) mate = 620865717

matches AAGE01358323.1 (-) 1201bp no P450

use the bottom of AAGE01358323 for (+) strand matches

runs ito a repeat

used first 500 bp of AAGE01062475 to find upstream seq

754331375 (-) goes upstream about 500bp, used this to find contig

no good match in WGS

mate = 754341923 matches AAGE01358323.1 (+) 1201 bp

use top of AAGE01358323 for (+) matches (bottom had repeat matches)

still in repeat

This older strategy lacked info in insert sizes and went way too far


Used more (-) strand matches and mate pairs to go upstrem only 4-8000bp

AAGE01269113.1(-) matches 587973945 mate of 587971423

That matches near the end of AAGE01062475, insert = 4000bp no P450

574232774(-) also matches end of AAGE01062475 mate = 574236320

insert 4000bp this also matches AAGE01269113

529565709 matches end of AAGE01062475, mate = 529515150

insert = 8500bp. 529515150 matches AAGE01426036.1(+) 1067bp

used 821692110 to extend 754331375 toward AAGE01269113

this eq overlapped AAGE01269113

used 1200-1700bp of AAGE01062475 to locate (-) mate pairs between

AAGE01269113 and AAGE01426036

820321218(-) had mate pair 821692110 3500bp upstream

matches AAGE01269113

826039570(-) has mate pair = 826154743 3500bp upstream

matches AAGE01269113

tried end of AAGE01269113 to extend upstream toward AAGE01426036

587871645(-) extends into gap 370bp

this seq matches AAGE01638768.1(-) 695bp

which points toward AAGE01426036

use all of AAGE01638768 to find (+) matches

578717187(+) mate = 580122653 3500bp apart

579657839(+) extends about 400bp mate = 579661406 4000bp insert

579661406 matches AAGE01435940.1(+) 1050bp

also matches AAGE01318937.1(+) 1292bp

also matches AAGE01407923.1

580122653 extends AAGE01426036 upstream about 500bp

578477469 extends AAGE01426036 downstream 465bp

AAGE01463180.1(-) extends 578477469 upstream toward 579657839

Now looking upstream of AAGE01407923

754331417 is a mate pair of 754330948 (-) 9500 bp insert

520562795 is a mate pair of 520665364(-) 8500 bp insert

matches AAGE01000444.1 (-) 20031bp no P450

832502264 is a mate pair of 832503627(-) 3500 bp insert

matches AAGE01441151.1(-) 1041bp







>AAGE01064173 68% to AAGE01050332 N-term complete

used 1-1960 in a mate pair search no P450 found so used

(-) mate pairs for WGS searches

618075209(-) mate = 614737464

matches AAGE01295005.1 (-) 1353bp no P450

this contig also found in search for AAGE01196445

on opposite orientation as expected from a search from opposite direction


AAGE01196445 67% to AAGE01062475 832452467 825244079 (C-term)

used first 500bp to find trace file seqs on (-) strand to get mate pairs upstream

579928179 (-) mate = 579928178

matches AAGE01295005.1 (+) 1353bp no P450

755009935 (+) moves upstream about 400bp

used this to look for next contig = AAGE01295005.1

used first 300bp of this seq to find trace files (-) strand

827560763 (-) mate = 826196777 in a repeat

matches AAGE01327171.1 (+) 1272bp no P450

revisited this seq used all of AAGE01295005 to find more (-) mate pairs

810114220 (-) in a TGGAAGAC repeat mate = 810112302

matches AAGE01538741.1 (+) 908bp no P450

621935132 (-)in a TGGAAGAC repeat mate = 621783691

matches AAGE01090366.1 (+) 2758bp no P450

use top of AAGE01090366 to find (-) matches

834948650(-) mate = 835990450 matches repeat AAGE01090366

749639099(-) mate = 749632674 no good match

811933234(-) mate = 810057071 in a repeat

593164368(-) mate = 593170808 in a repeat

used middle of AAGE01090366 to find (-) strand matches

591745757(-) mate = 591749328 in a repeat

576250249(-) mate = 576246693 in a repeat

use top of AAGE01090366 to walk upstream

572277727 moves upstream 477 bp

used this to find the immediate upstream contig

AAGE01469359.1 (=) 1001bp used top to walk upstream

615889895(-) goes about 400 bp upstream (end of seq)

592717583 (-) further extends this seq now in a repeat

579616263 (+) goes back 448bp further

579057965 (+) goes another 450bp

569646653 (-) adds about 650 bp

520152779 (+) moves back about 200bp

cannot get past the repeat












>AAGE01039338 43% to 325C2 N-term complete













AAGE02009773.1 Length=286003 FAAK boundary based on a similar EST EB099011.1

Revise KSKS boundary based on exact EST DW992488.1 use this seq










183305  FSGGSRNCI (1)



>AAGE01030046.1  43% to 325F2 complete











>AAGE01516637 AAGE01063015 67% to AAGE01030046, 818793338 820291982 complete

AAGE01269282 55% to 325F2 74% to AAGE01030046, probable end of AAGE01516637

Used botttom of AAGE01269282 to find (+) strand matches

632852730 (+) mate = 630141349 matches AAGE01063015.1












AAGE02023793.1 Length=162318 use this seq













>AAGE01193335.1 AAGE01182945.1 N-term  65% to 325E1

probable N-term exon of AAGE01245552

813462501 581487574 588882777 586123749 752854417

637742616 matches on (+) mate pair = 638510990

this matches a repeat

813462501 (+) mate = 812771386

matches AAGE01220928.1 (-) no P450

760274997 (+) mate = 761367180

matches AAGE01191443.1 (+) 1746bp no P450

use first 500 bp of AAGE01191443 to find a (-) hit in megablast

use the mate pair to keep moving toward exon 2

569712697 (-) mate = 569677085

this matches AAGE01120174.1 (-) 2321 bp no P450

use the end of AAGE01120174 to find a (+) match to continue

636174306 (+) mate = 637134652

this matches AAGE01597709.1 (+) 813bp no P450

812154070 (+) mate = 813112864, 813497943

matches AAGE01353363.1 (+) 1212bp no P450

568529646 (+) mate = 568526082

matches a repeat




>AAGE01245552.1 TC58401 new 53% to AAGE01045021 65% to 325E


Walked to 574319237

Walked to 744143898

Walked to 637124801 and 821753900 mate pair = 821670798 matches C-term

Walked to 836005807

Walked to 825766500

Walked to 755025265 mate pair = 755028846 matches DTWK and on

Walked to 745181680

Walked to 827540437 mate pair = 825766500 above

Walked to 529568074 mate pair = 531429449 matches DTWK

Walked to 757636880 mate pair 757640457 is upstream, may jump over the repeat

Walked to 529232002 runs into a large repeat region

Decided to continue the walk upstream of 757640457

Walked to 583632437 ran into a gap upstream

Tried going downstream of 757640457 toward repeat region

Walked to 519868279











AAGE02000570.1 fifth of five P450s on this contig = AAGE01193335.1 use this seq



continues on AAGE02000571.1













>AAGE01001430 44% to 325F2 263506881 complete



 8957 YSFFQVSRGIFSAP (1) 8998









AAGE02023796.1 Length=287591 use this revised seq



16046  LQYSFFQVSRGIFSAP (1) 16002

       VDLWKILR  15400









>AAGE01347884 494537782 61% to 325F2 like 325H1 613935093 complete

AAGE01293591 61% to AAGE01303772 overlaps with 613935093

50% to AAGE01001430

used first part of AAGE01069052 to find trace files on the (-) strand

749335708 was an imperfect match, but its mate pair

749342170 matches AAGE01347884,

585893297 (-) mate = 585809237

matches AAGE01311378.1 (-) 1311bp no P450

591378293 (-) mate = no mate

803283930 (-) mate = 793222515

matches AAGE01125396.1 (+) 2262bp no P450

595130292 (-) mate = 594343693

matches AAGE01311378.1 (-)

also matches AAGE01184369.1 (+) 1787bp no P450

594343603 (-) mate = 595131586

matches AAGE01184369.1 AAGE01311378.1

AAGE01069052.1 best match to exon 1 of AAGE01001430, but cannot link it

To the rest of this gene yet.)











AAGE02023793.1 Length=162318 use this seq



88479  VSRGIFSSP (1) 88505










>AAGE01011003 832457338 this seq overlaps 639393192  complete

591547547 mate pair = 591382861 matches AAGE01153865

51% to 325K1 N-term The next best match is 325E1 at 43%

AAGE01153865 494304406 639393192 58% to 476430416 52% to 325K1

223521505 76% to 476430416 60% to 325K












AAGE02009247.1 Length=85986 use this seq

note trace file 832457338 supports the other seq (allele?)







15390  IIA (0) 15398




16582  LAGPHAVSLERRR* 16623


>AAGE01421194.1 N-term 756213770 51% to AAGE01011003 complete

AAGE01614450.1 AAGE01034413.1 (at least 5000bp to exon 3)

End of exon 2 is a the beginning of AAGE01034413(+)

Probably joins with AAGE01045021 since both are highly similar to AAGE01011003

Tried mate pair search with end and middle of AAGE01034413.1, no success

825266760 walked down to 578617426 used end to search again

looked for (+) match to end of AAGE01034413 to find mate pair in

next contig 592715947(+) mate = 592712372

matches AAGE01302867.1 (+) 1333bp

matches AAGE01045021.1 (+) 100%

AAGE01045021 61% to 325K 476430416 58% to 494304406 66% to AAGE01011003













AAGE02009247.1 Length=85986, use my seq, same as below (second gene on contig)













>AAGE01082531.1 complete

494292861 494251906 61% to 325G1

AAGE01491115.1 67% to 325G1




918  TLDMIC  935









AAGE02023796.1 Length=287591 use this seq with correct intron boundaries








47316  TSPTRI (1) 47333




>AAGE01073923.1 51% to 325G1 complete 70% to AAGE01082531.1













>AAGE01008633.1 325-like N-term 38% to AAGE01132222 complete

AAGE01074064.1 42% to 325C3 40% to AAGE01041126

on (-) strand so use bottom of AAGE01074064 to find (+) matches

813467254(+) mate = 811970297

matches AAGE01540337.1 (+) 905bp no P450

744058557(+) mate = 744054987

matches AAGE01196471.1 (+) 1719bp

625161011(+) mate = 625110150

matches AAGE01196471

use top of AAGE01196471 to look for (-) strand matches

813876897(-) mate = 813126749

matches AAGE01008633.1 (-) 9433bp = N-term of P450 join












AAGE02006231.1 Length=220788 use this seq












>AAGE01303772 AAGE01114730 476159771 58% to 494251906 60% to 325F2

57% to AAGE01020741

used AAGE01152759 to search for trace files that were about 75% identical

found 595132659 (67-255) 71% to AAGE01152759 might complete this seq











AAGE02021468.1 Length=30723 use this seq



16083  MISAP (1)









14743  TLEKR* 14726


AAGE02023793.1 Length=162318 4 P450s on this contig at 15k, 41k, 79k, 151k


This is an N-term only used incorrectly above as a part of AAGE01303772


>AAGE01152759 75% to AAGE01303772 overlaps AAGE01124741 in exon 2 complete

AAGE01124741.1 AAGE01593486 AAGE01487633.1

43% to 325F1 56% to AAGE01020741

61% to AAGE01303772








     DQHTIPAN  912




AAGE02021469.1 Length=21097 use this seq


11016  KAIAGTLKYFSKF  10978



10617  RDISKCTLDQIY (1) 10582





9428   DQHTIPANCTII  9393




>AAGE01004435.1 might match with AAGE01020741 complete

try searching with first 1000bp of AAGE01004435 for (-) strand matches

600018362 (-) mate = 600015159

matches AAGE01442713 (-) seen below in repeat region when searching

for extension to AAGE01020741.  This is evidence that these two seqs

are from the same gene, but not real strong evidence, since the match

is in a repeat region.

591948070(-) mate = 591747525

matches AAGE01406894.1 (+) 1102 bp

also matches AAGE01215974.1 (-) 1623 bp

Provisionally join AAGE01004435 and AAGE01020741

AAGE01020741.1 43% to 325F2 missing exon 1 57% to AAGE01303772

used top 1000bp of AAGE01020741 to look for (-) trace file seqs

to get mate pairs upstream

825198586 (-) mate = no mate

579619346(-) mate = 579123534

matches AAGE01028893.1 (+) 5378bp no P450

592231766(-) mate = 592238195

matches AAGE01028893.1 (+)

repeat with top 1000bp of AAGE01028893

this jumps upstream more than 5000bp and continues the search

579492092(-) mate = 579485641

matches AAGE01267250.1 (+) 1433bp no P450

578717559 (-) mate = 580123560

matches AAGE01442713.1 (+) 1039bp no P450 repeat region

520662500(-) mate = 528593949

matches AAGE01299598.1(-) 1341bp no P450 repeat region

761358767(-) mate = 760269002

matches AAGE01284342.1(-) 1383bp no P450

also matches AAGE01097354.1(-) 2636bp no P450

also matches AAGE01125726.1 (+) 2259bp no P450










2378 IANGVLMSLEKR*  2416


Mitochondrial clan sequences (note CYP49 not found yet)


>CYP301A1 AAGE01019797 476402901 520186080 585804951 600015456 520527252

574225018 636187512 528806294 88% to CYP301A1

note anoph 301A1 has 4 extra aa after VGIDT (probably an error at an intron boundary) complete











>CYP49A1 AAGE01096311 yellow = potential intron, does not match with anopheles

90% to anopheles CYP49A1 complete

578793495 587596076 637745631 815234501 621923398 600556551 574277444














>CYP302A1v2 AY947550 missing last exon











AAGE02035843.1  Length=4920 only one diff at intron boundary, use my boundary

7aa diffs to AY947550, 6 aa diffs to AY947549











1362  NMLVLLLR (0)



>CYP302A1v1 AY947549 AAGE01063658 complete 76% to 302A1 Anopheles

8 aa diffs to AY947550, an allele?












AAGE02020818.1 Length=128320 3 aa diffs to AY947549, use this seq

11 aa diffs to AY947550, 6aa diffs to AAGE02035843 (allele?)


       NVKPYNQIPG  48451

48450  PRGPFGLGNLYQYIPGI (1) 48400












>CYP314A1 AY947552 complete 63% to 314A1 Anopheles












>CYP315A1 AY947551 494561798 494528462 complete 48% to 315A1 Anopheles











AAGE02021700.1 Length=168697 use this seq



142338  KCKRGLFFM (2) 142364


142591  ESVLYKWSIE (1)


148028  FERIVPESLAI (1)




148503  AIIGDYCIAKN (0)





>CYP12F8 ae11 AAGE01032419 AAGE01086349 TC54878 TC56637 56% to CYP12F2

757957630 570857480 636185159 complete

578659905  634992373  826015391  815163912  749851347













AAGE02011045.1 Length=46523 first exon  use this seq

AAGE02011046.1 Length=152209 exons 2-6





      MI  3305









>TC62801 TC30081 TC42104 62% to CYP12F2 only 3 aa diffs to TC62802









>This seq has good matches to 633797604 745118857 578662923 (2 nuc diffs up to PKG)

No exact matches to the 547 and higher part of this seq.  I am pretty sure that

TC62801 is the same gene as TC62802
















>CYP12F5 AAGE01014703 TC62802 TC30082 TC42105 59% to CYP12F2 576558364 519971711

633083599 AAGE01014703.1 genomic clone in WGS section of genbank

note the two seqs are 93% identical at the nucleotide level













>CYP12F7 AAGE01039158.1 CYP12F N-term exon complete

end of this contig matches 579038185 803270410 580023179 832546439

821664975 walked from here to try to find seq DR747927


did a blast of the first 2kb of AAGE01039158 against WGS with megablast and then

searched the mate pairs for a match. 519876045 had a mate pair = 519934913 that

matched DR747927. Therefore this first exon belongs to DR747927 and it completes

that gene.

DR747927 18 July 2005 EST AAGE01381702 AAGE01102867

63% to 12F2 223403769

592051743 627484635 569653177 578234080 528591681













>CYP12F6 new AAGE01025257.1 AAGE01059738 AAGE01062828 762706782 633806669

520523625 826091106 832456020 824229657 749956998 complete













AAGE02003131.1 Length=176362 use this seq


26997  LKNFVPE (1) 27017












220 Aedes accession numbers from NCBI WGS section in order

AAGE01000026.1  1e-50

AAGE01000868.1  9e-26 2 genes

AAGE01001298.1  9e-39 incomp 2 genes

AAGE01001411.1  9e-31

AAGE01001430.1  1e-45

AAGE01001451.1  3e-28 incomp

AAGE01002325.1  1e-20

AAGE01003123.1  6e-23 pseudogene

AAGE01003202.1  1e-19

AAGE01003592.1  5e-54

AAGE01003622.1  2e-24

AAGE01004063.1  1e-36

AAGE01004071.1  2e-15

AAGE01004684.1  3e-27

AAGE01004894.1  6e-19

AAGE01005096.1  6e-24

AAGE01005098.1  1e-69

AAGE01005157.1  2e-35

AAGE01005255.1  5e-32 incomp

AAGE01005406.1  3e-18

AAGE01005840.1  1e-32 incomp

AAGE01005986.1  2e-23

AAGE01006231.1  1e-26

AAGE01006393.1  3e-37 incomp

AAGE01007189.1  5e-21

AAGE01008959.1  2e-18

AAGE01009694.1  4e-41 incomp

AAGE01009885.1  1e-32 incomp

AAGE01010708.1  2e-43

AAGE01011003.1  5e-23 incomp

AAGE01011017.1  3e-17

AAGE01012031.1  3e-20

AAGE01012700.1  3e-18

AAGE01014192.1  3e-28

AAGE01014703.1  2e-59

AAGE01015732.1  5e-29

AAGE01015749.1  4e-68

AAGE01015918.1  8e-37 incomp

AAGE01018213.1  5e-38 incomp

AAGE01019797.1  2e-49

AAGE01020246.1  4e-19

AAGE01020741.1  1e-87 incomp

AAGE01021462.1  3e-68 incomp

AAGE01021812.1  9e-36 incomp

AAGE01021887.1  9e-62

AAGE01021948.1  3e-27

AAGE01023514.1  5e-29

AAGE01023613.1  4e-23

AAGE01024111.1  1e-17

AAGE01024167.1  4e-27 incomp

AAGE01024220.1  3e-62 incomp

AAGE01024260.1  6e-22

AAGE01025218.1  4e-37

AAGE01025257.1  3e-61

AAGE01025833.1  2e-09

AAGE01026029.1  1e-29 incomp

AAGE01026936.1  3e-44

AAGE01026951.1  2e-64

AAGE01027375.1  1e-34

AAGE01027431.1  4e-71

AAGE01028822.1  6e-46

AAGE01029369.1  1e-55 incomp

AAGE01029809.1  4e-22

AAGE01030046.1  4e-68

AAGE01031181.1  1e-19

AAGE01032419.1  1e-99

AAGE01032555.1  9e-17

AAGE01035444.1  4e-23

AAGE01039338.1  2e-24 incomp

AAGE01039952.1  6e-24

AAGE01041126.1  3e-45 incomp

AAGE01041187.1  2e-18

AAGE01043608.1  2e-29 incomp

AAGE01044016.1  2e-24

AAGE01045021.1  9e-44 incomp

AAGE01046733.1  7e-30 incomp

AAGE01047465.1  5e-23

AAGE01047841.1  6e-19

AAGE01048909.1  4e-35

AAGE01049176.1  6e-39

AAGE01050332.1  4e-33 incomp

AAGE01051792.1  4e-44 incomp

AAGE01051934.1  2e-19

AAGE01052546.1  2e-19 pseudogene

AAGE01054542.1  1e-24

AAGE01054827.1  4e-33 incomp

AAGE01055570.1  4e-41 incomp

AAGE01059014.1  3e-42 incomp

AAGE01059738.1  3e-28

AAGE01062475.1  7e-28 incomp

AAGE01062828.1  9e-26

AAGE01063015.1  2e-28 incomp

AAGE01063458.1  1e-26

AAGE01063658.1  2e-30

AAGE01064173.1  8e-57 incomp

AAGE01064689.1  6e-71

AAGE01065173.1  2e-50 incomp

AAGE01065191.1  7e-20

AAGE01065801.1  3e-24

AAGE01070673.1  3e-30 incomp

AAGE01072700.1  7e-36

AAGE01073711.1  1e-21 incomp

AAGE01073923.1  3e-101

AAGE01074064.1  1e-44 incomp

AAGE01075209.1  1e-64 incomp

AAGE01075759.1  8e-27 incomp

AAGE01076911.1  4e-41

AAGE01078331.1  1e-59

AAGE01078584.1  1e-39 pseudogene

AAGE01081732.1  2e-08

AAGE01082298.1  6e-28

AAGE01082531.1  1e-59

AAGE01082714.1  2e-27

AAGE01083421.1  5e-46

AAGE01084906.1  2e-31 incomp

AAGE01086349.1  2e-132

AAGE01088707.1  2e-73

AAGE01096311.1  3e-11

AAGE01098313.1  2e-15 pseudogene

AAGE01099852.1  7e-23

AAGE01102043.1  2e-33

AAGE01102574.1  1e-30 2 genes

AAGE01102867.1  2e-77 incomp

AAGE01104491.1  2e-10

AAGE01105997.1  1e-15 incomp

AAGE01106416.1  7e-34

AAGE01108571.1  4e-23

AAGE01109944.1  2e-15

AAGE01111617.1  3e-31 incomp

AAGE01114730.1  2e-40 incomp

AAGE01114834.1  1e-34 incomp

AAGE01116725.1  4e-26 incomp

AAGE01116789.1  9e-25

AAGE01118978.1  5e-33

AAGE01123974.1  4e-18 pseudogene

AAGE01124741.1  2e-72 incomp

AAGE01124926.1  2e-26 incomp

AAGE01125862.1  8e-24

AAGE01126587.1  2e-24 incomp

AAGE01129498.1  4e-09

AAGE01132222.1  5e-35 incomp

AAGE01133741.1  1e-25

AAGE01138953.1  6e-40 incomp

AAGE01139230.1  2e-33 incomp

AAGE01142069.1  6e-24

AAGE01143020.1  4e-50 incomp

AAGE01147701.1  5e-37 incomp

AAGE01152759.1  1e-46 incomp

AAGE01153865.1  3e-41 incomp

AAGE01171970.1  1e-23

AAGE01172381.1  2e-25

AAGE01173027.1  1e-52

AAGE01179692.1  3e-21

AAGE01185776.1  6e-20

AAGE01187448.1  3e-27

AAGE01192518.1  3e-07 incomp

AAGE01194580.1  3e-90

AAGE01196445.1  2e-20 incomp

AAGE01198540.1  4e-21

AAGE01198792.1  1e-20 2 genes

AAGE01206292.1  3e-33

AAGE01206812.1  1e-25

AAGE01213118.1  6e-22 incomp

AAGE01216085.1  3e-33 incomp

AAGE01224146.1  6e-35 incomp

AAGE01225620.1  1e-26 incomp

AAGE01226366.1  2e-37 incomp

AAGE01227048.1  6e-21 pseudogene

AAGE01227180.1  6e-43 incomp

AAGE01227281.1  5e-35

AAGE01228356.1  8e-35

AAGE01234290.1  4e-41

AAGE01236202.1  2e-21

AAGE01239763.1  1e-78 incomp

AAGE01245552.1  2e-54 incomp

AAGE01253357.1  2e-117

AAGE01259804.1  5e-29

AAGE01266366.1  1e-20

AAGE01269158.1  1e-21 incomp

AAGE01269282.1  6e-37 incomp

AAGE01273771.1  3e-23

AAGE01277917.1  1e-21

AAGE01288441.1  2e-32 incomp

AAGE01293591.1  4e-39 incomp

AAGE01298676.1  2e-36 incomp

AAGE01303772.1  4e-41 incomp

AAGE01321728.1  3e-21

AAGE01331087.1  4e-39 incomp

AAGE01337778.1  1e-18

AAGE01338874.1  1e-61

AAGE01339434.1  2e-23

AAGE01340100.1  2e-36 incomp

AAGE01341824.1  2e-22 incomp

AAGE01347884.1  2e-41 incomp

AAGE01378346.1  8e-35

AAGE01381118.1  7e-55 incomp

AAGE01381702.1  1e-48 incomp

AAGE01395583.1  3e-38 incomp

AAGE01397643.1  3e-24 incomp

AAGE01400897.1  9e-23 incomp

AAGE01406122.1  5e-22

AAGE01408667.1  6e-30

AAGE01439874.1  5e-30

AAGE01449675.1  2e-59

AAGE01462557.1  3e-46 incomp

AAGE01484914.1  1e-24 incomp

AAGE01489548.1  8e-32 incomp

AAGE01491115.1  4e-62 incomp

AAGE01493222.1  3e-36

AAGE01504815.1  3e-21

AAGE01516637.1  2e-33 incomp

AAGE01528761.1  2e-25

AAGE01531287.1  4e-55 incomp

AAGE01553900.1  2e-22

AAGE01569058.1  2e-25

AAGE01574909.1  4e-39

AAGE01584611.1  8e-32 incomp

AAGE01593486.1  3e-18 incomp

AAGE01635404.1  2e-40

AAGE01635520.1  7e-89


Blast of Broad Institute new assembly of Oct 6 2005-09-22

Query= 6331

        (52 letters)

Database: /seq/annotation/blast_databases/insect/aedes_aegypti/aedes_a


          4758 sequences; 1,383,971,543 total letters


                                                                  Score     E

Sequences producing significant alignments:                        (bits)  Value

Aedes aegypti supercontig 1.6                                         106  9e-23

Aedes aegypti supercontig 1.174                                        54  7e-07

Aedes aegypti supercontig 1.738                                        50  1e-05

Aedes aegypti supercontig 1.610                                        45  3e-04

Aedes aegypti supercontig 1.3561                                       43  0.002

Aedes aegypti supercontig 1.3299                                       42  0.002

Aedes aegypti supercontig 1.187                                        42  0.003

Aedes aegypti supercontig 1.106                                        42  0.004

Aedes aegypti supercontig 1.170                                        41  0.005

Aedes aegypti supercontig 1.283                                        40  0.011

Aedes aegypti supercontig 1.467                                        40  0.014

Aedes aegypti supercontig 1.457                                        37  0.092

Aedes aegypti supercontig 1.105                                        36  0.20

Aedes aegypti supercontig 1.197                                        32  3.9

Aedes aegypti supercontig 1.1912                                       32  3.9

Aedes aegypti supercontig 1.778                                        30  8.6

>Aedes aegypti supercontig 1.6

         Length = 5075626


>AAGE01025218 Frame = +












>AAGE01064173 Frame = +









3975117 VQARNPNAYMPFSSGSRNCI (1) 3975176



>AAGE01050332 + AAGE01245552 Frame = +









4013677 CRDRNPNAYMPFSTGARNCI (1) 4013736



>AAGE01024167b + AAGE01224146 Frame = -









4030645 VLVFEHWVKIEKRRYNC* 4030592


>AAGE01001298.1 gene b Frame = -

 Frame = -1





4050956 NRQYAAE (0) 4050936




4043481 CRTRPAGVFIPFSTGPRDCI (1) 4043422



>AAGE01001298.1 gene a + AAGE01043608 Frame = -








4062248 KGRHPFAYVPFSGGNRNCI (1) 4062192



>AAGE01056055 Frame = + just exon 1, not a complete seq 57% to AAGE01193335

This gene is 16kb downstream and in the same orientation.  This might be

An alternative exon 1 for AAGE01193335




no P450 in interval between 4105567 and 4121642


>AAGE01193335 + Frame = +












>494087031 Frame = + with new N-term

N-term matches 836008679 836009201 812170512 591454297 625040575












>AAGE01077592 Frame = -

note bottom of this seq is very similar (6aa diffs) to AAGE01056055.

AAGE01056055 assembled wrong. an end for AAGE01056055 does not exist










4541780 IEKR* 4541766


>Aedes aegypti supercontig 1.170

         Length = 2080708

>AAGE01046733 Frame = +












>AAGE01011475 Frame = +












>AAGE01102953 Frame = +2 possible alternative exon 1 for AAGE01205264 22.4kb away




No P450 seq in this interval


>AAGE01205264 Frame = +1













>Aedes aegypti supercontig 1.174

         Length = 1986401


> AAGE01132222 Frame = -3


              MLLVL++ +V+L  +L  S  + +  KFA ++ S+ P YPLLG+A + +  S+  RFE




              + +  + DR+ K W GPQ++ +  HP+LVQ++L+  +C EKPF Y F+    GLF++K



> AAGE01421194 Frame = -3


              M+ +L V + I   VL     ++K KFA A+P  +P YP++GN  + + K+  E F ++




               F +HDR+  +     + +   HP+L+Q++L+  DC EKP +Y      +GL  ++



> AAGE01011003 Frame = +1


              ML  +S+ ++I+  ++      K  FA  +P  QP YP++GN  I     KS  E    +




                F +HDRM  +  GP++ +   HP+LVQQ+L+   C EK  +Y       GL +SK



>Aedes aegypti supercontig 1.174

         Length = 1986401

 Frame = -3


              S+W+  RKALN T +  +L +F+P FE FS+ +V+KL  Y EG+ +DIL  T



 Frame = +2


              +W+  RK LN+TF+  IL +F+P F   +++L+  L QY   G T +IL P+T



>Aedes aegypti supercontig 1.738

         Length = 536643


 Frame = +1


             LWRSQRKALN++  P+IL +FIP F   S  LVD L +Y G



 Frame = +3


              A LW+  RK LN+ F+  IL  FIP FE    ++V  L Q  +G T D++  T



 Frame = -2


              +W+ QRKALN  FS +I+   +P F    ++L+  L QY G      T+DIL  T



 Frame = +2


              +W++QRKA N  F P+IL +F+P F      L++ L Q+ G      T DIL  T



 Frame = +3


              AS+W+  RK L+  FSP+IL +F+  F   S+ LV +L +  G



 Frame = +2


             A +WR QRK LN +F P IL  F+  F   S+ L   +  + G



 Frame = -1